Rmu_sc0029736.1_g000003

Ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0029736.1
OG0025594
Physical Location & Seq
Reverse (-)
4556 .. 5517
962 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0029736.1_g000003.1.cds

Sequence Viewer

Length: 654 bp
atggccgaagcaagggtcgatcttacggcagtgtggcttctgaatgactatgcacgagtctctctgggatcaacgggactggaggcattatctggactcactattcatgatgtgggggatcgctttgtttttcagtttgaacgtgaaactgttgctgtcaaggggctacctttgattttacacaataagacggccttgcatctggttggatcatctctaggtcatgttatacggtttgatcaaactgcgttgcacaaaaaggaagaagaacaacgcattcgtctggctttcaatgttagatgccggattcagagttggaatctgtttgagttctcaccggtggtggttccggaactcacgttcatgtatgataagatcaaaggcttatgtaggggatgtggtcttttcgagcatgatgttaggggctgcgatctcttgttggaaaaagagaaggaggaggttttggctaaaccaccggaagctgctatggccatgttggcattgggttggagcatcatgcagcccagtcggaaactcaagaggcctgcattccaagatagtgggggagcttccaccctttcggagcagccttttgctgggttcaatatgacaacatttctgaagacatgggcagcgggggaccttcaaaaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4283 Exo_endo_phos_2 RNase_H RVT_1 zf-CCHC_4

Protein Analysis

217

Amino Acids

24.29

Weight (kDa)

7.01

Isoelectric Point (pI)

42.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025594)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0005287.1_g000003 Rmu_sc0029736.1_g000003
rosa_rugosa Rorug04G0330300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 349
AciI CCGC 1 cut(s) 635
AclWI GGATC 3 cut(s) 76, 126, 217
AcoI YGGCCR 2 cut(s) 3, 489
AcuI CTGAAG 1 cut(s) 641
AfiI CCNNNNNNNGG 2 cut(s) 12, 596
AgeI ACCGGT 1 cut(s) 337
AgsI TTSAA 4 cut(s) 140, 292, 604, 647
AloI GAACNNNNNNTCC 2 cut(s) 344, 376
AluBI AGCT 2 cut(s) 482, 569
AluI AGCT 2 cut(s) 482, 569
Alw26I GTCTC 1 cut(s) 64
AlwI GGATC 3 cut(s) 76, 126, 217
Aor13HI TCCGGA 1 cut(s) 349
AoxI GGCC 4 cut(s) 3, 192, 489, 542
ApeKI GCWGC 5 cut(s) 426, 482, 520, 586, 632
ArsI GACNNNNNNTTYG 1 cut(s) 32
AsiGI ACCGGT 1 cut(s) 337
AspS9I GGNCC 1 cut(s) 640
AsuHPI GGTGA 1 cut(s) 327
AvaII GGWCC 1 cut(s) 640
BalI TGGCCA 1 cut(s) 491
BauI CACGAG 1 cut(s) 54
BbsI GAAGAC 1 cut(s) 629
BbvI GCAGC 5 cut(s) 413, 469, 532, 598, 644
BceAI ACGGC 2 cut(s) 42, 207
BcgI CGANNNNNNTGC 2 cut(s) 509, 543
BclI TGATCA 1 cut(s) 238
BcoDI GTCTC 1 cut(s) 64
BfaI CTAG 1 cut(s) 218
BglI GCCNNNNNGGC 1 cut(s) 497
BisI GCNGC 5 cut(s) 427, 483, 521, 587, 633
BlsI GCNGC 5 cut(s) 428, 484, 522, 588, 634
Bme18I GGWCC 1 cut(s) 640
BmgT120I GGNCC 1 cut(s) 640
BmiI GGNNCC 2 cut(s) 348, 641
BmrI ACTGGG 1 cut(s) 519
BmsI GCATC 3 cut(s) 208, 290, 522
BmuI ACTGGG 1 cut(s) 519
BpiI GAAGAC 1 cut(s) 629
BpmI CTGGAG 1 cut(s) 101
BpuEI CTTGAG 1 cut(s) 521
BsaWI WCCGGW 3 cut(s) 337, 349, 475
Bsc4I CCNNNNNNNGG 2 cut(s) 12, 596
Bse118I RCCGGY 1 cut(s) 337
Bse1I ACTGG 2 cut(s) 84, 525
BseAI TCCGGA 1 cut(s) 349
BseGI GGATG 1 cut(s) 401
BseLI CCNNNNNNNGG 2 cut(s) 12, 596
BseNI ACTGG 2 cut(s) 84, 525
BseRI GAGGAG 1 cut(s) 470
BseXI GCAGC 5 cut(s) 413, 469, 532, 598, 644
BseYI CCCAGC 1 cut(s) 596
BshFI GGCC 4 cut(s) 5, 194, 491, 544
BshTI ACCGGT 1 cut(s) 337
BsiSI CCGG 4 cut(s) 304, 338, 350, 476
BslFI GGGAC 1 cut(s) 90
BslI CCNNNNNNNGG 2 cut(s) 12, 596
BsmAI GTCTC 1 cut(s) 64
BsmFI GGGAC 1 cut(s) 90
BsmI GAATGC 2 cut(s) 276, 548
BsnI GGCC 4 cut(s) 5, 194, 491, 544
Bsp13I TCCGGA 1 cut(s) 349
Bsp143I GATC 7 cut(s) 19, 68, 118, 209, 238, 375, 430
BspACI CCGC 1 cut(s) 635
BspANI GGCC 4 cut(s) 5, 194, 491, 544
BspEI TCCGGA 1 cut(s) 349
BspHI TCATGA 1 cut(s) 106
BspLI GGNNCC 2 cut(s) 348, 641
BspPI GGATC 3 cut(s) 76, 126, 217
BsrFI RCCGGY 1 cut(s) 337
BsrI ACTGG 2 cut(s) 84, 525
BssAI RCCGGY 1 cut(s) 337
BssMI GATC 7 cut(s) 19, 68, 118, 209, 238, 375, 430
BssSI CACGAG 1 cut(s) 54
Bst2BI CACGAG 1 cut(s) 54
Bst4CI ACNGT 2 cut(s) 151, 234
BstC8I GCNNGC 1 cut(s) 546
BstF5I GGATG 1 cut(s) 401
BstKTI GATC 7 cut(s) 22, 71, 121, 212, 241, 378, 433
BstMAI GTCTC 1 cut(s) 64
BstMBI GATC 7 cut(s) 19, 68, 118, 209, 238, 375, 430
BstMWI GCNNNNNNNGC 2 cut(s) 488, 497
BstV1I GCAGC 5 cut(s) 413, 469, 532, 598, 644
BstV2I GAAGAC 1 cut(s) 629
BstXI CCANNNNNNTGG 1 cut(s) 560
BsuRI GGCC 4 cut(s) 5, 194, 491, 544
BtsCI GGATG 1 cut(s) 401
BtsI GCAGTG 1 cut(s) 36
BtsIMutI CAGTG 1 cut(s) 36
Cac8I GCNNGC 1 cut(s) 546
CciI TCATGA 1 cut(s) 106
Cfr10I RCCGGY 1 cut(s) 337
Cfr13I GGNCC 1 cut(s) 640
CspAI ACCGGT 1 cut(s) 337
CviAII CATG 7 cut(s) 107, 224, 364, 413, 493, 517, 627
DpnI GATC 7 cut(s) 21, 70, 120, 211, 240, 377, 432
DpnII GATC 7 cut(s) 19, 68, 118, 209, 238, 375, 430
EaeI YGGCCR 2 cut(s) 3, 489
Eco147I AGGCCT 1 cut(s) 544
Eco47I GGWCC 1 cut(s) 640
Eco57I CTGAAG 1 cut(s) 641
EcoO109I RGGNCCY 1 cut(s) 640
FaeI CATG 7 cut(s) 110, 227, 367, 416, 496, 520, 630
FalI AAGNNNNNCTT 2 cut(s) 179, 211
FaqI GGGAC 1 cut(s) 90
FatI CATG 7 cut(s) 106, 223, 363, 412, 492, 516, 626
FauI CCCGC 1 cut(s) 628
FbaI TGATCA 1 cut(s) 238
Fnu4HI GCNGC 5 cut(s) 427, 483, 521, 587, 633
FokI GGATG 1 cut(s) 408
Fsp4HI GCNGC 5 cut(s) 427, 483, 521, 587, 633
FspBI CTAG 1 cut(s) 218
GluI GCNGC 5 cut(s) 427, 483, 521, 587, 633
GsaI CCCAGC 1 cut(s) 600
GsuI CTGGAG 1 cut(s) 101
HaeIII GGCC 4 cut(s) 5, 194, 491, 544
HapII CCGG 4 cut(s) 304, 338, 350, 476
Hin1II CATG 7 cut(s) 110, 227, 367, 416, 496, 520, 630
HinfI GANTC 4 cut(s) 57, 96, 307, 319
HpaII CCGG 4 cut(s) 304, 338, 350, 476
HphI GGTGA 1 cut(s) 327
Hpy188I TCNGA 5 cut(s) 42, 312, 531, 583, 621
Hpy188III TCNNGA 4 cut(s) 93, 107, 350, 538
HpyAV CCTTC 2 cut(s) 445, 653
HpyCH4III ACNGT 2 cut(s) 151, 234
HpyCH4IV ACGT 2 cut(s) 142, 359
HpyCH4V TGCA 5 cut(s) 53, 199, 253, 520, 548
HpyF10VI GCNNNNNNNGC 2 cut(s) 488, 497
HpySE526I ACGT 2 cut(s) 142, 359
Hsp92II CATG 7 cut(s) 110, 227, 367, 416, 496, 520, 630
Kpn2I TCCGGA 1 cut(s) 349
Ksp22I TGATCA 1 cut(s) 238
Kzo9I GATC 7 cut(s) 19, 68, 118, 209, 238, 375, 430
LmnI GCTCC 3 cut(s) 510, 566, 583
Lsp1109I GCAGC 5 cut(s) 413, 469, 532, 598, 644
LweI GCATC 3 cut(s) 208, 290, 522
MaeI CTAG 1 cut(s) 218
MaeII ACGT 2 cut(s) 142, 359
MalI GATC 7 cut(s) 21, 70, 120, 211, 240, 377, 432
MboI GATC 7 cut(s) 19, 68, 118, 209, 238, 375, 430
MboII GAAGA 3 cut(s) 275, 278, 634
MlsI TGGCCA 1 cut(s) 491
MluNI TGGCCA 1 cut(s) 491
MlyI GAGTC 2 cut(s) 66, 90
MmeI TCCRAC 5 cut(s) 187, 296, 420, 488, 509
MnlI CCTC 4 cut(s) 76, 448, 451, 534
Mox20I TGGCCA 1 cut(s) 491
MroI TCCGGA 1 cut(s) 349
MscI TGGCCA 1 cut(s) 491
MslI CAYNNNNRTG 1 cut(s) 362
Msp20I TGGCCA 1 cut(s) 491
MspA1I CMGCKG 1 cut(s) 635
MspI CCGG 4 cut(s) 304, 338, 350, 476
Mva1269I GAATGC 2 cut(s) 276, 548
MwoI GCNNNNNNNGC 2 cut(s) 488, 497
NdeII GATC 7 cut(s) 19, 68, 118, 209, 238, 375, 430
NlaIII CATG 7 cut(s) 110, 227, 367, 416, 496, 520, 630
NlaIV GGNNCC 2 cut(s) 348, 641
PagI TCATGA 1 cut(s) 106
PceI AGGCCT 1 cut(s) 544
PctI GAATGC 2 cut(s) 276, 548
PfeI GAWTC 2 cut(s) 307, 319
PinAI ACCGGT 1 cut(s) 337
PkrI GCNGC 5 cut(s) 428, 484, 522, 588, 634
PleI GAGTC 2 cut(s) 65, 90
PpsI GAGTC 2 cut(s) 65, 90
PpuMI RGGWCCY 1 cut(s) 640
Psp5II RGGWCCY 1 cut(s) 640
PspFI CCCAGC 1 cut(s) 596
PspN4I GGNNCC 2 cut(s) 348, 641
PspPI GGNCC 1 cut(s) 640
PspPPI RGGWCCY 1 cut(s) 640
RseI CAYNNNNRTG 1 cut(s) 362
SatI GCNGC 5 cut(s) 427, 483, 521, 587, 633
Sau3AI GATC 7 cut(s) 19, 68, 118, 209, 238, 375, 430
Sau96I GGNCC 1 cut(s) 640
SchI GAGTC 2 cut(s) 66, 90
SetI ASST 8 cut(s) 145, 172, 223, 362, 462, 484, 571, 645
SfaNI GCATC 3 cut(s) 208, 290, 522
SgrAI CRCCGGYG 1 cut(s) 337
SinI GGWCC 1 cut(s) 640
SmiMI CAYNNNNRTG 1 cut(s) 362
SmlI CTYRAG 1 cut(s) 536
SmoI CTYRAG 1 cut(s) 536
SseBI AGGCCT 1 cut(s) 544
SsiI CCGC 1 cut(s) 635
SspMI CTAG 1 cut(s) 218
StuI AGGCCT 1 cut(s) 544
TaaI ACNGT 2 cut(s) 151, 234
TaiI ACGT 2 cut(s) 145, 362
TaqI TCGA 2 cut(s) 18, 408
TfiI GAWTC 2 cut(s) 307, 319
TscAI CASTG 1 cut(s) 36
TseI GCWGC 5 cut(s) 426, 482, 520, 586, 632
TspDTI ATGAA 2 cut(s) 95, 352
TspRI CASTG 1 cut(s) 36
VpaK11BI GGWCC 1 cut(s) 640
XcmI CCANNNNNNNNNTGG 1 cut(s) 499
XspI CTAG 1 cut(s) 218
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.