Rmu_sc0031735.1_g000003

ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0031735.1
OG0031034
Physical Location & Seq
Forward (+)
3515 .. 3994
480 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0031735.1_g000003.1.cds

Sequence Viewer

Length: 480 bp
atgcttcctttcaagatacttgtttggaattgtcaaggtattaacaacaccccgacccaagatgctctcttgaatttaatgcgtctcaaacgccctagtttgatttttctttcagccctagctgctctagatctgttgacctcagttcagtgtaatttaggatttgatggctgtttttgtgttgattccaaggatgagtatagaggtttgccacttctttggctcaatgaagttccggtgaggctaagtaattactcatcaaatcatattgatgcagaagttggaggacttggctcaaataaggtgtttagatttacaaggatctatggagttgttagaaccagagagagaatcttcacttgggatctgttacgccctcttgctcgacaatctctgcttccttggttggttgctggagactttaatgaaatcttgtgccaagcagacaaatcgggtggccctccccggagtgcggcatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 RVT_3 zf-RVT

Protein Analysis

159

Amino Acids

17.83

Weight (kDa)

8.69

Isoelectric Point (pI)

36.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031034)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0000071.1_g000006 Rmu_sc0031735.1_g000003

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 473
AclWI GGATC 2 cut(s) 329, 372
AcsI RAATTY 1 cut(s) 73
AfiI CCNNNNNNNGG 1 cut(s) 472
AgsI TTSAA 2 cut(s) 13, 73
AjuI GAANNNNNNNTTGG 2 cut(s) 343, 375
AluBI AGCT 1 cut(s) 122
AluI AGCT 1 cut(s) 122
Alw26I GTCTC 2 cut(s) 89, 411
AlwI GGATC 2 cut(s) 329, 372
AoxI GGCC 1 cut(s) 457
ApeKI GCWGC 1 cut(s) 122
ApoI RAATTY 1 cut(s) 73
AspS9I GGNCC 1 cut(s) 458
AsuC2I CCSGG 1 cut(s) 466
AsuHPI GGTGA 1 cut(s) 250
BbvI GCAGC 1 cut(s) 109
BccI CCATC 1 cut(s) 161
BcgI CGANNNNNNTGC 2 cut(s) 432, 466
BcnI CCSGG 1 cut(s) 466
BcoDI GTCTC 2 cut(s) 89, 411
BfaI CTAG 3 cut(s) 96, 119, 128
BglII AGATCT 1 cut(s) 130
BisI GCNGC 2 cut(s) 123, 474
BlsI GCNGC 2 cut(s) 124, 475
Bme1390I CCNGG 1 cut(s) 466
BmgT120I GGNCC 1 cut(s) 458
BmrFI CCNGG 1 cut(s) 466
BmsI GCATC 2 cut(s) 52, 262
BpmI CTGGAG 1 cut(s) 435
BpuMI CCSGG 1 cut(s) 466
BsaJI CCNNGG 3 cut(s) 189, 401, 464
BsaWI WCCGGW 1 cut(s) 235
Bsc4I CCNNNNNNNGG 1 cut(s) 472
BseDI CCNNGG 3 cut(s) 189, 401, 464
BseGI GGATG 1 cut(s) 199
BseLI CCNNNNNNNGG 1 cut(s) 472
BseMII CTCAG 1 cut(s) 156
BseXI GCAGC 1 cut(s) 109
BshFI GGCC 1 cut(s) 459
BsiSI CCGG 2 cut(s) 236, 466
BslI CCNNNNNNNGG 1 cut(s) 472
BsmAI GTCTC 2 cut(s) 89, 411
BsmBI CGTCTC 1 cut(s) 89
BsnI GGCC 1 cut(s) 459
Bsp143I GATC 3 cut(s) 130, 321, 364
BspACI CCGC 1 cut(s) 473
BspANI GGCC 1 cut(s) 459
BspCNI CTCAG 1 cut(s) 155
BspPI GGATC 2 cut(s) 329, 372
BssECI CCNNGG 3 cut(s) 189, 401, 464
BssMI GATC 3 cut(s) 130, 321, 364
BssT1I CCWWGG 2 cut(s) 189, 401
BstDEI CTNAG 2 cut(s) 142, 245
BstF5I GGATG 1 cut(s) 199
BstKTI GATC 3 cut(s) 133, 324, 367
BstMAI GTCTC 2 cut(s) 89, 411
BstMBI GATC 3 cut(s) 130, 321, 364
BstMWI GCNNNNNNNGC 1 cut(s) 122
BstSCI CCNGG 1 cut(s) 464
BstV1I GCAGC 1 cut(s) 109
BstX2I RGATCY 3 cut(s) 130, 321, 364
BstXI CCANNNNNNTGG 1 cut(s) 219
BstYI RGATCY 3 cut(s) 130, 321, 364
BsuRI GGCC 1 cut(s) 459
BtsCI GGATG 1 cut(s) 199
BtsIMutI CAGTG 1 cut(s) 155
Cfr13I GGNCC 1 cut(s) 458
CseI GACGC 1 cut(s) 71
CspCI CAANNNNNGTGG 2 cut(s) 436, 471
CviJI RGCY 7 cut(s) 116, 122, 171, 223, 244, 294, 459
CviKI_1 RGCY 7 cut(s) 116, 122, 171, 223, 244, 294, 459
DdeI CTNAG 2 cut(s) 142, 245
DpnI GATC 3 cut(s) 132, 323, 366
DpnII GATC 3 cut(s) 130, 321, 364
Eco130I CCWWGG 2 cut(s) 189, 401
EcoT14I CCWWGG 2 cut(s) 189, 401
ErhI CCWWGG 2 cut(s) 189, 401
Esp3I CGTCTC 1 cut(s) 89
FaiI YATR 4 cut(s) 201, 267, 327, 478
Fnu4HI GCNGC 2 cut(s) 123, 474
FokI GGATG 1 cut(s) 206
Fsp4HI GCNGC 2 cut(s) 123, 474
FspBI CTAG 3 cut(s) 96, 119, 128
GluI GCNGC 2 cut(s) 123, 474
GsuI CTGGAG 1 cut(s) 435
HaeIII GGCC 1 cut(s) 459
HapII CCGG 2 cut(s) 236, 466
HgaI GACGC 1 cut(s) 71
HincII GTYRAC 1 cut(s) 138
HindII GTYRAC 1 cut(s) 138
HinfI GANTC 2 cut(s) 185, 351
HpaII CCGG 2 cut(s) 236, 466
HphI GGTGA 1 cut(s) 250
Hpy166II GTNNAC 1 cut(s) 138
Hpy188III TCNNGA 3 cut(s) 13, 70, 128
Hpy8I GTNNAC 1 cut(s) 138
HpyCH4V TGCA 1 cut(s) 275
HpyF10VI GCNNNNNNNGC 1 cut(s) 122
HpyF3I CTNAG 2 cut(s) 142, 245
Kzo9I GATC 3 cut(s) 130, 321, 364
LpnPI CCDG 3 cut(s) 249, 355, 399
Lsp1109I GCAGC 1 cut(s) 109
LweI GCATC 2 cut(s) 52, 262
MaeI CTAG 3 cut(s) 96, 119, 128
MaeIII GTNAC 1 cut(s) 369
MalI GATC 3 cut(s) 132, 323, 366
MboI GATC 3 cut(s) 130, 321, 364
MboII GAAGA 1 cut(s) 346
MflI RGATCY 3 cut(s) 130, 321, 364
MluCI AATT 4 cut(s) 28, 73, 154, 250
MmeI TCCRAC 1 cut(s) 262
MnlI CCTC 6 cut(s) 151, 197, 234, 278, 387, 471
MseI TTAA 3 cut(s) 42, 77, 423
MslI CAYNNNNRTG 1 cut(s) 270
MspI CCGG 2 cut(s) 236, 466
MspR9I CCNGG 1 cut(s) 466
MwoI GCNNNNNNNGC 1 cut(s) 122
NciI CCSGG 1 cut(s) 466
NdeII GATC 3 cut(s) 130, 321, 364
PfeI GAWTC 2 cut(s) 185, 351
PkrI GCNGC 2 cut(s) 124, 475
PspPI GGNCC 1 cut(s) 458
PsuI RGATCY 3 cut(s) 130, 321, 364
RseI CAYNNNNRTG 1 cut(s) 270
SaqAI TTAA 3 cut(s) 42, 77, 423
SatI GCNGC 2 cut(s) 123, 474
Sau3AI GATC 3 cut(s) 130, 321, 364
Sau96I GGNCC 1 cut(s) 458
ScrFI CCNGG 1 cut(s) 466
SetI ASST 5 cut(s) 40, 124, 143, 208, 306
SfaNI GCATC 2 cut(s) 52, 262
SmiMI CAYNNNNRTG 1 cut(s) 270
Sse9I AATT 4 cut(s) 28, 73, 154, 250
SsiI CCGC 1 cut(s) 473
SspMI CTAG 3 cut(s) 96, 119, 128
StyD4I CCNGG 1 cut(s) 464
StyI CCWWGG 2 cut(s) 189, 401
TaqI TCGA 1 cut(s) 385
TasI AATT 4 cut(s) 28, 73, 154, 250
TauI GCSGC 1 cut(s) 476
TfiI GAWTC 2 cut(s) 185, 351
Tru1I TTAA 3 cut(s) 42, 77, 423
Tru9I TTAA 3 cut(s) 42, 77, 423
TscAI CASTG 1 cut(s) 155
TseI GCWGC 1 cut(s) 122
TspDTI ATGAA 2 cut(s) 243, 441
TspRI CASTG 1 cut(s) 155
XapI RAATTY 1 cut(s) 73
XbaI TCTAGA 1 cut(s) 127
XspI CTAG 3 cut(s) 96, 119, 128
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.