Rmu_sc0032032.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0032032.1
Physical Location & Seq
Forward (+)
1 .. 475
475 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0032032.1_g000001.1.cds

Sequence Viewer

Length: 315 bp
cttattgaatcagcaaaggatgggaatgagaccttggttttggcaagacaaaatgctgaccaactgattgaatcatcaagagatgggaaggagacctcggagttggcaagacaaaacaatgaccagcttgttgcttctgatgggaaggagaccttggatttggcaaaacaaaataatgaccagcttgttgaatctgcaagagatgtgaaggaccccttggttttggccaagaaaattaaaaggttgctcaaacgaattgaacgtctggtgccttgtaattgcaaaggtaacttttcttggaagtgggttttctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

104

Amino Acids

11.78

Weight (kDa)

7.95

Isoelectric Point (pI)

36.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0025417)

Species Orthologous Gene IDs
rosa_laevigata RLG00000034046
rosa_multiflora Rmu_sc0003005.1_g000023 Rmu_sc0032032.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 268
AcoI YGGCCR 1 cut(s) 225
AgsI TTSAA 4 cut(s) 8, 71, 191, 260
AjuI GAANNNNNNNTTGG 6 cut(s) 17, 49, 137, 169, 200, 232
AluBI AGCT 2 cut(s) 127, 184
AluI AGCT 2 cut(s) 127, 184
Alw26I GTCTC 3 cut(s) 23, 86, 143
AoxI GGCC 1 cut(s) 225
ArsI GACNNNNNNTTYG 6 cut(s) 22, 54, 142, 174, 247, 279
AspS9I GGNCC 1 cut(s) 211
AvaII GGWCC 1 cut(s) 211
BalI TGGCCA 1 cut(s) 227
BanI GGYRCC 1 cut(s) 268
BccI CCATC 3 cut(s) 14, 77, 134
BcoDI GTCTC 3 cut(s) 23, 86, 143
Bme18I GGWCC 1 cut(s) 211
BmgT120I GGNCC 1 cut(s) 211
BmiI GGNNCC 2 cut(s) 213, 270
BsaI GGTCTC 3 cut(s) 23, 86, 143
BsaJI CCNNGG 4 cut(s) 33, 96, 153, 216
BseDI CCNNGG 4 cut(s) 33, 96, 153, 216
BseGI GGATG 1 cut(s) 25
BshFI GGCC 1 cut(s) 227
BshNI GGYRCC 1 cut(s) 268
BsmAI GTCTC 3 cut(s) 23, 86, 143
BsnI GGCC 1 cut(s) 227
Bso31I GGTCTC 3 cut(s) 23, 86, 143
BspANI GGCC 1 cut(s) 227
BspLI GGNNCC 2 cut(s) 213, 270
BspT107I GGYRCC 1 cut(s) 268
BspTNI GGTCTC 3 cut(s) 23, 86, 143
BssECI CCNNGG 4 cut(s) 33, 96, 153, 216
BssT1I CCWWGG 3 cut(s) 33, 153, 216
BstF5I GGATG 1 cut(s) 25
BstMAI GTCTC 3 cut(s) 23, 86, 143
BsuRI GGCC 1 cut(s) 227
BtsCI GGATG 1 cut(s) 25
Cfr13I GGNCC 1 cut(s) 211
CviJI RGCY 3 cut(s) 127, 184, 227
CviKI_1 RGCY 3 cut(s) 127, 184, 227
EaeI YGGCCR 1 cut(s) 225
Eco130I CCWWGG 3 cut(s) 33, 153, 216
Eco31I GGTCTC 3 cut(s) 23, 86, 143
Eco47I GGWCC 1 cut(s) 211
EcoO109I RGGNCCY 1 cut(s) 211
EcoT14I CCWWGG 3 cut(s) 33, 153, 216
ErhI CCWWGG 3 cut(s) 33, 153, 216
FalI AAGNNNNNCTT 4 cut(s) 137, 169, 200, 232
FokI GGATG 1 cut(s) 32
HaeIII GGCC 1 cut(s) 227
HinfI GANTC 3 cut(s) 8, 71, 191
Hpy188I TCNGA 3 cut(s) 100, 139, 314
Hpy188III TCNNGA 1 cut(s) 78
HpyAV CCTTC 3 cut(s) 82, 139, 202
HpyCH4IV ACGT 1 cut(s) 262
HpyCH4V TGCA 2 cut(s) 197, 282
HpySE526I ACGT 1 cut(s) 262
LpnPI CCDG 3 cut(s) 137, 194, 251
MaeII ACGT 1 cut(s) 262
MaeIII GTNAC 1 cut(s) 287
MlsI TGGCCA 1 cut(s) 227
MluCI AATT 3 cut(s) 234, 255, 277
MluNI TGGCCA 1 cut(s) 227
MnlI CCTC 1 cut(s) 106
Mox20I TGGCCA 1 cut(s) 227
MscI TGGCCA 1 cut(s) 227
MseI TTAA 1 cut(s) 237
Msp20I TGGCCA 1 cut(s) 227
NlaIV GGNNCC 2 cut(s) 213, 270
PcsI WCGNNNNNNNCGW 1 cut(s) 259
PfeI GAWTC 3 cut(s) 8, 71, 191
PpuMI RGGWCCY 1 cut(s) 211
Psp5II RGGWCCY 1 cut(s) 211
PspN4I GGNNCC 2 cut(s) 213, 270
PspPI GGNCC 1 cut(s) 211
PspPPI RGGWCCY 1 cut(s) 211
SaqAI TTAA 1 cut(s) 237
Sau96I GGNCC 1 cut(s) 211
SetI ASST 8 cut(s) 35, 98, 129, 155, 186, 245, 265, 289
SinI GGWCC 1 cut(s) 211
Sse9I AATT 3 cut(s) 234, 255, 277
StyI CCWWGG 3 cut(s) 33, 153, 216
TaiI ACGT 1 cut(s) 265
TasI AATT 3 cut(s) 234, 255, 277
TfiI GAWTC 3 cut(s) 8, 71, 191
Tru1I TTAA 1 cut(s) 237
Tru9I TTAA 1 cut(s) 237
VpaK11BI GGWCC 1 cut(s) 211
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.