Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0032494.1

Orthogroup ID

OG0025145

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 406

Gene Structure 405 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0032494.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 210 bp

atgaatggtcagcaccaacaacagcacaacccaactccccagcatcctcaaagggatgctaacaacccagctggtcttctagcaattgcggaggagaccttggcagagttcctttccaaggctactggaactgctgtcgactgggtccagatgattgggatgaagcctggtccggattctattggaatcgtcgctgtgtcccgcaactcc

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0003002 GO:0003006 GO:0003674 GO:0003676 GO:0003677 GO:0003700 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0006355 GO:0007275 GO:0007389 GO:0008150 GO:0009653 GO:0009790 GO:0009791 GO:0009793 GO:0009798 GO:0009799 GO:0009855 GO:0009880 GO:0009888 GO:0009889 GO:0009908 GO:0009933 GO:0009943 GO:0009944 GO:0009955 GO:0010014 GO:0010016 GO:0010072 GO:0010154 GO:0010468 GO:0010556 GO:0019219 GO:0019222 GO:0022414 GO:0031323 GO:0031326 GO:0032501 GO:0032502 GO:0035670 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044464 GO:0048316 GO:0048367 GO:0048437 GO:0048438 GO:0048440 GO:0048467 GO:0048481 GO:0048507 GO:0048508 GO:0048532 GO:0048608 GO:0048731 GO:0048827 GO:0048856 GO:0050789 GO:0050794 GO:0051171 GO:0051252 GO:0060255 GO:0061458 GO:0065001 GO:0065007 GO:0080060 GO:0080090 GO:0090421 GO:0090567 GO:0097159 GO:0099402 GO:0140110 GO:1901363 GO:1903506 GO:2000112 GO:2001141

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Homeobox MEKHLA START

Protein Analysis

70

Amino Acids

7.47

Weight (kDa)

5.77

Isoelectric Point (pI)

25.17

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025145)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr7g0215011
rosa_multiflora	Rmu_sc0032241.1_g000001 Rmu_sc0032494.1_g000001

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	138
AccIII	TCCGGA	1 cut(s)	172
AciI	CCGC	2 cut(s)	89, 202
AfiI	CCNNNNNNNGG	1 cut(s)	118
AjnI	CCWGG	1 cut(s)	166
AluBI	AGCT	1 cut(s)	71
AluI	AGCT	1 cut(s)	71
Alw26I	GTCTC	1 cut(s)	89
Aor13HI	TCCGGA	1 cut(s)	172
AspS9I	GGNCC	2 cut(s)	145, 170
AvaII	GGWCC	2 cut(s)	145, 170
BbsI	GAAGAC	1 cut(s)	68
BciT130I	CCWGG	1 cut(s)	168
BcoDI	GTCTC	1 cut(s)	89
BfaI	CTAG	1 cut(s)	80
Bme1390I	CCNGG	1 cut(s)	168
Bme18I	GGWCC	2 cut(s)	145, 170
BmgT120I	GGNCC	2 cut(s)	145, 170
BmiI	GGNNCC	1 cut(s)	146
BmrFI	CCNGG	1 cut(s)	168
BmrI	ACTGGG	1 cut(s)	151
BmsI	GCATC	2 cut(s)	46, 52
BmuI	ACTGGG	1 cut(s)	151
BpiI	GAAGAC	1 cut(s)	68
BsaI	GGTCTC	1 cut(s)	89
BsaJI	CCNNGG	2 cut(s)	99, 117
BsaWI	WCCGGW	1 cut(s)	172
Bsc4I	CCNNNNNNNGG	1 cut(s)	118
Bse1I	ACTGG	2 cut(s)	130, 146
BseAI	TCCGGA	1 cut(s)	172
BseBI	CCWGG	1 cut(s)	168
BseDI	CCNNGG	2 cut(s)	99, 117
BseGI	GGATG	3 cut(s)	43, 61, 165
BseLI	CCNNNNNNNGG	1 cut(s)	118
BseNI	ACTGG	2 cut(s)	130, 146
BseRI	GAGGAG	1 cut(s)	107
BseYI	CCCAGC	2 cut(s)	39, 67
BsiSI	CCGG	1 cut(s)	173
BslFI	GGGAC	1 cut(s)	184
BslI	CCNNNNNNNGG	1 cut(s)	118
BsmAI	GTCTC	1 cut(s)	89
BsmFI	GGGAC	1 cut(s)	184
Bso31I	GGTCTC	1 cut(s)	89
Bsp13I	TCCGGA	1 cut(s)	172
BspACI	CCGC	2 cut(s)	89, 202
BspEI	TCCGGA	1 cut(s)	172
BspLI	GGNNCC	1 cut(s)	146
BspTNI	GGTCTC	1 cut(s)	89
BsrI	ACTGG	2 cut(s)	130, 146
BssECI	CCNNGG	2 cut(s)	99, 117
BssT1I	CCWWGG	2 cut(s)	99, 117
Bst2UI	CCWGG	1 cut(s)	168
BstENI	CCTNNNNNAGG	1 cut(s)	116
BstF5I	GGATG	3 cut(s)	43, 61, 165
BstMAI	GTCTC	1 cut(s)	89
BstNI	CCWGG	1 cut(s)	168
BstSCI	CCNGG	1 cut(s)	166
BstV2I	GAAGAC	1 cut(s)	68
BstXI	CCANNNNNNTGG	1 cut(s)	155
BtsCI	GGATG	3 cut(s)	43, 61, 165
Cfr13I	GGNCC	2 cut(s)	145, 170
CviJI	RGCY	3 cut(s)	71, 122, 166
CviKI_1	RGCY	3 cut(s)	71, 122, 166
Eco130I	CCWWGG	2 cut(s)	99, 117
Eco31I	GGTCTC	1 cut(s)	89
Eco47I	GGWCC	2 cut(s)	145, 170
EcoNI	CCTNNNNNAGG	1 cut(s)	116
EcoRII	CCWGG	1 cut(s)	166
EcoT14I	CCWWGG	2 cut(s)	99, 117
ErhI	CCWWGG	2 cut(s)	99, 117
FaqI	GGGAC	1 cut(s)	184
FblI	GTMKAC	1 cut(s)	138
FokI	GGATG	3 cut(s)	30, 68, 172
FspBI	CTAG	1 cut(s)	80
GsaI	CCCAGC	2 cut(s)	43, 71
HapII	CCGG	1 cut(s)	173
HincII	GTYRAC	1 cut(s)	139
HindII	GTYRAC	1 cut(s)	139
HinfI	GANTC	2 cut(s)	176, 186
HpaII	CCGG	1 cut(s)	173
Hpy166II	GTNNAC	1 cut(s)	139
Hpy188III	TCNNGA	2 cut(s)	148, 173
Hpy8I	GTNNAC	1 cut(s)	139
Hpy99I	CGWCG	1 cut(s)	194
Kpn2I	TCCGGA	1 cut(s)	172
LpnPI	CCDG	9 cut(s)	53, 57, 81, 111, 127, 153, 161, 180, 186
LweI	GCATC	2 cut(s)	46, 52
MaeI	CTAG	1 cut(s)	80
MboII	GAAGA	1 cut(s)	68
MfeI	CAATTG	1 cut(s)	84
MluCI	AATT	1 cut(s)	84
MnlI	CCTC	2 cut(s)	57, 85
MroI	TCCGGA	1 cut(s)	172
MspA1I	CMGCKG	1 cut(s)	71
MspI	CCGG	1 cut(s)	173
MspR9I	CCNGG	1 cut(s)	168
MunI	CAATTG	1 cut(s)	84
MvaI	CCWGG	1 cut(s)	168
NlaIV	GGNNCC	1 cut(s)	146
PfeI	GAWTC	2 cut(s)	176, 186
PflFI	GACNNNGTC	1 cut(s)	143
Psp6I	CCWGG	1 cut(s)	166
PspFI	CCCAGC	2 cut(s)	39, 67
PspGI	CCWGG	1 cut(s)	166
PspN4I	GGNNCC	1 cut(s)	146
PspPI	GGNCC	2 cut(s)	145, 170
PsyI	GACNNNGTC	1 cut(s)	143
PvuII	CAGCTG	1 cut(s)	71
SalI	GTCGAC	1 cut(s)	137
Sau96I	GGNCC	2 cut(s)	145, 170
ScrFI	CCNGG	1 cut(s)	168
SetI	ASST	2 cut(s)	73, 101
SfaNI	GCATC	2 cut(s)	46, 52
SinI	GGWCC	2 cut(s)	145, 170
Sse9I	AATT	1 cut(s)	84
SsiI	CCGC	2 cut(s)	89, 202
SspMI	CTAG	1 cut(s)	80
StyD4I	CCNGG	1 cut(s)	166
StyI	CCWWGG	2 cut(s)	99, 117
TaqI	TCGA	1 cut(s)	138
TasI	AATT	1 cut(s)	84
TfiI	GAWTC	2 cut(s)	176, 186
TspDTI	ATGAA	2 cut(s)	17, 176
Tth111I	GACNNNGTC	1 cut(s)	143
VpaK11BI	GGWCC	2 cut(s)	145, 170
XagI	CCTNNNNNAGG	1 cut(s)	116
XmiI	GTMKAC	1 cut(s)	138
XspI	CTAG	1 cut(s)	80

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.