Rmu_sc0040590.1_g000001

Leucine-rich repeat receptor-like protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0040590.1
Physical Location & Seq
Reverse (-)
2 .. 887
886 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0040590.1_g000001.1.cds

Sequence Viewer

Length: 183 bp
atgtcggtgatcgccggttcctacggctacattgcaccagagtatgcttataccctccaagttgatgagaagagtgacatatacagcttcggggttgtgctattggagattttaagcggaaagagatcggtggaggcgattttcggggatgggaatagcattgtggattgggttcggacgaaa

Protein Analysis

61

Amino Acids

6.72

Weight (kDa)

4.51

Isoelectric Point (pI)

35.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0031600)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0040590.1_g000001 Rmu_sc0040591.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 117
AluBI AGCT 1 cut(s) 87
AluI AGCT 1 cut(s) 87
AsuHPI GGTGA 1 cut(s) 19
BccI CCATC 1 cut(s) 143
BceAI ACGGC 1 cut(s) 40
BmiI GGNNCC 1 cut(s) 19
Bse118I RCCGGY 1 cut(s) 14
Bse3DI GCAATG 1 cut(s) 30
BseGI GGATG 1 cut(s) 154
BseMI GCAATG 1 cut(s) 30
BsiSI CCGG 1 cut(s) 15
Bsp143I GATC 2 cut(s) 9, 125
BspACI CCGC 1 cut(s) 117
BspLI GGNNCC 1 cut(s) 19
BsrDI GCAATG 1 cut(s) 30
BsrFI RCCGGY 1 cut(s) 14
BssAI RCCGGY 1 cut(s) 14
BssMI GATC 2 cut(s) 9, 125
Bst6I CTCTTC 1 cut(s) 65
BstF5I GGATG 1 cut(s) 154
BstKTI GATC 2 cut(s) 12, 128
BstMBI GATC 2 cut(s) 9, 125
BtsCI GGATG 1 cut(s) 154
Cfr10I RCCGGY 1 cut(s) 14
CviJI RGCY 2 cut(s) 27, 87
CviKI_1 RGCY 2 cut(s) 27, 87
DpnI GATC 2 cut(s) 11, 127
DpnII GATC 2 cut(s) 9, 125
Eam1104I CTCTTC 1 cut(s) 65
EarI CTCTTC 1 cut(s) 65
FaiI YATR 4 cut(s) 45, 51, 80, 82
FokI GGATG 1 cut(s) 161
HapII CCGG 1 cut(s) 15
HpaII CCGG 1 cut(s) 15
HphI GGTGA 1 cut(s) 19
Hpy188I TCNGA 1 cut(s) 177
HpyCH4V TGCA 1 cut(s) 35
Kzo9I GATC 2 cut(s) 9, 125
LpnPI CCDG 2 cut(s) 28, 51
MaeIII GTNAC 1 cut(s) 74
MalI GATC 2 cut(s) 11, 127
MboI GATC 2 cut(s) 9, 125
MboII GAAGA 1 cut(s) 82
MnlI CCTC 2 cut(s) 65, 127
MseI TTAA 1 cut(s) 113
MspI CCGG 1 cut(s) 15
NdeII GATC 2 cut(s) 9, 125
NlaIV GGNNCC 1 cut(s) 19
NmuCI GTSAC 1 cut(s) 74
PcsI WCGNNNNNNNCGW 1 cut(s) 134
PspN4I GGNNCC 1 cut(s) 19
SaqAI TTAA 1 cut(s) 113
Sau3AI GATC 2 cut(s) 9, 125
SetI ASST 1 cut(s) 89
SgeI CNNG 5 cut(s) 27, 50, 71, 103, 157
SsiI CCGC 1 cut(s) 117
Tru1I TTAA 1 cut(s) 113
Tru9I TTAA 1 cut(s) 113
TseFI GTSAC 1 cut(s) 74
Tsp45I GTSAC 1 cut(s) 74
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.