Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0040591.1

Orthogroup ID

OG0031600

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 885

Gene Structure 884 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0040591.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 183 bp

atgtcggtgatcgccggttcatacggctacattgcaccagagtatgcttatacactccaagttgatgagaagagtgacatatacagcttcggggttgtgctactggagattttaagcggaaagagatcggtggaggcgattttcggggatgggaatagcattgtggattgggttcggacgaaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0001763 GO:0003006 GO:0005575 GO:0005623 GO:0005886 GO:0007275 GO:0008150 GO:0009653 GO:0009790 GO:0009791 GO:0009793 GO:0009888 GO:0009987 GO:0010016 GO:0010065 GO:0010067 GO:0010087 GO:0010089 GO:0010154 GO:0010223 GO:0010346 GO:0016020 GO:0022414 GO:0032501 GO:0032502 GO:0044464 GO:0048316 GO:0048367 GO:0048507 GO:0048508 GO:0048608 GO:0048646 GO:0048731 GO:0048856 GO:0051301 GO:0061458 GO:0071944 GO:1905393

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

LRRNT_2 LRR_1 LRR_6 LRR_8 Pkinase

Protein Analysis

61

Amino Acids

6.72

Weight (kDa)

4.51

Isoelectric Point (pI)

35.23

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031600)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_sc0040590.1_g000001 Rmu_sc0040591.1_g000001

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	117
AluBI	AGCT	1 cut(s)	87
AluI	AGCT	1 cut(s)	87
AsuHPI	GGTGA	1 cut(s)	19
BccI	CCATC	1 cut(s)	143
BceAI	ACGGC	1 cut(s)	40
BpmI	CTGGAG	1 cut(s)	125
Bse118I	RCCGGY	1 cut(s)	14
Bse1I	ACTGG	1 cut(s)	108
Bse3DI	GCAATG	1 cut(s)	30
BseGI	GGATG	1 cut(s)	154
BseMI	GCAATG	1 cut(s)	30
BseNI	ACTGG	1 cut(s)	108
BsiSI	CCGG	1 cut(s)	15
Bsp143I	GATC	2 cut(s)	9, 125
BspACI	CCGC	1 cut(s)	117
BsrDI	GCAATG	1 cut(s)	30
BsrFI	RCCGGY	1 cut(s)	14
BsrI	ACTGG	1 cut(s)	108
BssAI	RCCGGY	1 cut(s)	14
BssMI	GATC	2 cut(s)	9, 125
Bst6I	CTCTTC	1 cut(s)	65
BstF5I	GGATG	1 cut(s)	154
BstKTI	GATC	2 cut(s)	12, 128
BstMBI	GATC	2 cut(s)	9, 125
BtsCI	GGATG	1 cut(s)	154
Cfr10I	RCCGGY	1 cut(s)	14
CviJI	RGCY	2 cut(s)	27, 87
CviKI_1	RGCY	2 cut(s)	27, 87
DpnI	GATC	2 cut(s)	11, 127
DpnII	GATC	2 cut(s)	9, 125
Eam1104I	CTCTTC	1 cut(s)	65
EarI	CTCTTC	1 cut(s)	65
FaiI	YATR	5 cut(s)	22, 45, 51, 80, 82
FokI	GGATG	1 cut(s)	161
GsuI	CTGGAG	1 cut(s)	125
HapII	CCGG	1 cut(s)	15
HpaII	CCGG	1 cut(s)	15
HphI	GGTGA	1 cut(s)	19
Hpy188I	TCNGA	1 cut(s)	177
HpyCH4V	TGCA	1 cut(s)	35
Kzo9I	GATC	2 cut(s)	9, 125
LpnPI	CCDG	3 cut(s)	28, 51, 89
MaeIII	GTNAC	1 cut(s)	74
MalI	GATC	2 cut(s)	11, 127
MboI	GATC	2 cut(s)	9, 125
MboII	GAAGA	1 cut(s)	82
MnlI	CCTC	1 cut(s)	127
MseI	TTAA	1 cut(s)	113
MspI	CCGG	1 cut(s)	15
NdeII	GATC	2 cut(s)	9, 125
NmuCI	GTSAC	1 cut(s)	74
PcsI	WCGNNNNNNNCGW	1 cut(s)	134
SaqAI	TTAA	1 cut(s)	113
Sau3AI	GATC	2 cut(s)	9, 125
SetI	ASST	1 cut(s)	89
SgeI	CNNG	6 cut(s)	27, 50, 71, 103, 116, 157
SsiI	CCGC	1 cut(s)	117
Tru1I	TTAA	1 cut(s)	113
Tru9I	TTAA	1 cut(s)	113
TseFI	GTSAC	1 cut(s)	74
Tsp45I	GTSAC	1 cut(s)	74
TspDTI	ATGAA	1 cut(s)	9

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.