Rmu_sc0042692.1_g000001

Phosphoenolpyruvate phosphomutase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0042692.1
Physical Location & Seq
Forward (+)
1 .. 666
666 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0042692.1_g000001.1.cds

Sequence Viewer

Length: 156 bp
gctggattcttggacggaatcaccaatatagttccagctcttgggggtgtaaacatcaaagaattgttgaatgaggcagctgatggaatgggagggaagcagctgttagattttaatgacacaatgggtgatagaattcaagtttttctagagtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

51

Amino Acids

5.39

Weight (kDa)

4.15

Isoelectric Point (pI)

25.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0030106)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0408761
rosa_multiflora Rmu_sc0042692.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 41
AcsI RAATTY 1 cut(s) 135
AfiI CCNNNNNNNGG 1 cut(s) 41
AgsI TTSAA 2 cut(s) 70, 140
AluBI AGCT 3 cut(s) 38, 80, 103
AluI AGCT 3 cut(s) 38, 80, 103
ApeKI GCWGC 2 cut(s) 77, 100
ApoI RAATTY 1 cut(s) 135
AsuHPI GGTGA 2 cut(s) 13, 140
BbvI GCAGC 2 cut(s) 89, 112
BccI CCATC 1 cut(s) 77
BfaI CTAG 1 cut(s) 149
BisI GCNGC 2 cut(s) 78, 101
BlsI GCNGC 2 cut(s) 79, 102
Bsc4I CCNNNNNNNGG 1 cut(s) 41
BseLI CCNNNNNNNGG 1 cut(s) 41
BseXI GCAGC 2 cut(s) 89, 112
BslI CCNNNNNNNGG 1 cut(s) 41
BstV1I GCAGC 2 cut(s) 89, 112
CviJI RGCY 3 cut(s) 38, 80, 103
CviKI_1 RGCY 3 cut(s) 38, 80, 103
EcoRI GAATTC 1 cut(s) 135
FaiI YATR 1 cut(s) 29
Fnu4HI GCNGC 2 cut(s) 78, 101
Fsp4HI GCNGC 2 cut(s) 78, 101
FspBI CTAG 1 cut(s) 149
GluI GCNGC 2 cut(s) 78, 101
HinfI GANTC 2 cut(s) 6, 18
HphI GGTGA 2 cut(s) 13, 140
Hpy166II GTNNAC 1 cut(s) 52
Hpy188III TCNNGA 1 cut(s) 149
Hpy8I GTNNAC 1 cut(s) 52
LpnPI CCDG 1 cut(s) 48
Lsp1109I GCAGC 2 cut(s) 89, 112
MaeI CTAG 1 cut(s) 149
MluCI AATT 2 cut(s) 62, 135
MnlI CCTC 2 cut(s) 67, 86
MseI TTAA 1 cut(s) 114
MspA1I CMGCKG 2 cut(s) 80, 103
PfeI GAWTC 2 cut(s) 6, 18
PflMI CCANNNNNTGG 1 cut(s) 41
PkrI GCNGC 2 cut(s) 79, 102
PvuII CAGCTG 2 cut(s) 80, 103
SaqAI TTAA 1 cut(s) 114
SatI GCNGC 2 cut(s) 78, 101
SetI ASST 3 cut(s) 40, 82, 105
SgeI CNNG 5 cut(s) 15, 22, 47, 53, 152
Sse9I AATT 2 cut(s) 62, 135
SspMI CTAG 1 cut(s) 149
TasI AATT 2 cut(s) 62, 135
TfiI GAWTC 2 cut(s) 6, 18
Tru1I TTAA 1 cut(s) 114
Tru9I TTAA 1 cut(s) 114
TseI GCWGC 2 cut(s) 77, 100
TspGWI ACGGA 1 cut(s) 30
Van91I CCANNNNNTGG 1 cut(s) 41
XapI RAATTY 1 cut(s) 135
XbaI TCTAGA 1 cut(s) 148
XspI CTAG 1 cut(s) 149
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.