Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000112.1

Orthogroup ID

OG0025450

Physical Location & Seq

Genomic Coordinates Forward (+)

92071 .. 92955

Gene Structure 885 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 321 bp

atggaaggtgcaatcttggtccatgcgccatcctctcctctatcatcaacttctcatccatctgtgattctgacccaagatggactgaagaaaatcacagcctataaggccgtcgaattcgtcgagtctagcctggttctcggcatcggcacctgctccacgaccaagcataccatcaatcgaatcggcgatctcctccggcaggggaagctccataacattgttggaatacccacctccagaaagaccacgagcaaacttgaagatgaggatggggacgagagagaggtgaagaagaagaagaagaaggagaagaggtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0003006 GO:0003674 GO:0003824 GO:0004751 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0007275 GO:0008150 GO:0008219 GO:0009791 GO:0009987 GO:0010228 GO:0016853 GO:0016860 GO:0016861 GO:0022414 GO:0032501 GO:0032502 GO:0044424 GO:0044464 GO:0048608 GO:0048731 GO:0048856 GO:0061458

KEGG Pathways

Metabolic & Signaling

ko00030 ko00710 ko01100 ko01110 ko01120 ko01130 ko01200 ko01230 map00030 map00710 map01100 map01110 map01120 map01130 map01200 map01230

Pfam Domains

Protein Families

Rib_5-P_isom_A

Protein Analysis

106

Amino Acids

11.61

Weight (kDa)

9.59

Isoelectric Point (pI)

39.71

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025450)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_sc0005852.1_g000007 Rmu_ssc0000112.1_g000017
rosa_samantha	Rh6AG414800

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	161
Acc36I	ACCTGC	1 cut(s)	161
AccB1I	GGYRCC	1 cut(s)	149
AcsI	RAATTY	1 cut(s)	116
AcuI	CTGAAG	1 cut(s)	107
AfiI	CCNNNNNNNGG	1 cut(s)	202
AgsI	TTSAA	1 cut(s)	263
AjnI	CCWGG	1 cut(s)	132
AluBI	AGCT	1 cut(s)	211
AluI	AGCT	1 cut(s)	211
AoxI	GGCC	1 cut(s)	108
ApoI	RAATTY	1 cut(s)	116
AspLEI	GCGC	1 cut(s)	28
AspS9I	GGNCC	1 cut(s)	19
AsuHPI	GGTGA	1 cut(s)	301
AvaII	GGWCC	1 cut(s)	19
BanI	GGYRCC	1 cut(s)	149
BauI	CACGAG	1 cut(s)	250
BccI	CCATC	5 cut(s)	37, 67, 74, 182, 266
BceAI	ACGGC	1 cut(s)	95
BciT130I	CCWGG	1 cut(s)	134
BfaI	CTAG	1 cut(s)	129
BfuAI	ACCTGC	1 cut(s)	161
BglI	GCCNNNNNGGC	1 cut(s)	107
Bme1390I	CCNGG	1 cut(s)	134
Bme18I	GGWCC	1 cut(s)	19
BmgT120I	GGNCC	1 cut(s)	19
BmiI	GGNNCC	1 cut(s)	151
BmrFI	CCNGG	1 cut(s)	134
BmsI	GCATC	1 cut(s)	153
BpmI	CTGGAG	1 cut(s)	223
BsaXI	ACNNNNNCTCC	1 cut(s)	302
Bsc4I	CCNNNNNNNGG	1 cut(s)	202
BseBI	CCWGG	1 cut(s)	134
BseGI	GGATG	3 cut(s)	29, 55, 277
BseLI	CCNNNNNNNGG	1 cut(s)	202
BseRI	GAGGAG	2 cut(s)	27, 185
BshFI	GGCC	1 cut(s)	110
BshNI	GGYRCC	1 cut(s)	149
BsiSI	CCGG	1 cut(s)	199
BslFI	GGGAC	1 cut(s)	290
BslI	CCNNNNNNNGG	1 cut(s)	202
BsmFI	GGGAC	1 cut(s)	290
BsnI	GGCC	1 cut(s)	110
Bsp143I	GATC	1 cut(s)	190
BspANI	GGCC	1 cut(s)	110
BspLI	GGNNCC	1 cut(s)	151
BspMI	ACCTGC	1 cut(s)	161
BspT107I	GGYRCC	1 cut(s)	149
BssMI	GATC	1 cut(s)	190
BssSI	CACGAG	1 cut(s)	250
Bst2BI	CACGAG	1 cut(s)	250
Bst2UI	CCWGG	1 cut(s)	134
Bst6I	CTCTTC	1 cut(s)	308
BstENI	CCTNNNNNAGG	1 cut(s)	200
BstF5I	GGATG	3 cut(s)	29, 55, 277
BstHHI	GCGC	1 cut(s)	28
BstKTI	GATC	1 cut(s)	193
BstMBI	GATC	1 cut(s)	190
BstMWI	GCNNNNNNNGC	2 cut(s)	107, 208
BstNI	CCWGG	1 cut(s)	134
BstSCI	CCNGG	1 cut(s)	132
BsuRI	GGCC	1 cut(s)	110
BtsCI	GGATG	3 cut(s)	29, 55, 277
BveI	ACCTGC	1 cut(s)	161
CfoI	GCGC	1 cut(s)	28
Cfr13I	GGNCC	1 cut(s)	19
CviAII	CATG	1 cut(s)	23
CviJI	RGCY	4 cut(s)	101, 110, 132, 211
CviKI_1	RGCY	4 cut(s)	101, 110, 132, 211
DpnI	GATC	1 cut(s)	192
DpnII	GATC	1 cut(s)	190
Eam1104I	CTCTTC	1 cut(s)	308
EarI	CTCTTC	1 cut(s)	308
Eco47I	GGWCC	1 cut(s)	19
Eco57I	CTGAAG	1 cut(s)	107
EcoNI	CCTNNNNNAGG	1 cut(s)	200
EcoRI	GAATTC	1 cut(s)	116
EcoRII	CCWGG	1 cut(s)	132
FaeI	CATG	1 cut(s)	26
FaiI	YATR	4 cut(s)	24, 105, 171, 216
FaqI	GGGAC	1 cut(s)	290
FatI	CATG	1 cut(s)	22
FokI	GGATG	3 cut(s)	16, 42, 284
FspBI	CTAG	1 cut(s)	129
GlaI	GCGC	1 cut(s)	27
GsuI	CTGGAG	1 cut(s)	223
HaeIII	GGCC	1 cut(s)	110
HapII	CCGG	1 cut(s)	199
HhaI	GCGC	1 cut(s)	28
Hin1II	CATG	1 cut(s)	26
Hin6I	GCGC	1 cut(s)	26
HinP1I	GCGC	1 cut(s)	26
HinfI	GANTC	3 cut(s)	67, 125, 183
HpaII	CCGG	1 cut(s)	199
HphI	GGTGA	1 cut(s)	301
Hpy188I	TCNGA	1 cut(s)	72
Hpy188III	TCNNGA	1 cut(s)	240
Hpy99I	CGWCG	2 cut(s)	116, 125
HpyAV	CCTTC	1 cut(s)	301
HpyCH4V	TGCA	1 cut(s)	11
HpyF10VI	GCNNNNNNNGC	2 cut(s)	107, 208
Hsp92II	CATG	1 cut(s)	26
HspAI	GCGC	1 cut(s)	26
Kzo9I	GATC	1 cut(s)	190
LmnI	GCTCC	2 cut(s)	161, 216
LpnPI	CCDG	6 cut(s)	119, 146, 166, 188, 212, 253
LweI	GCATC	1 cut(s)	153
MaeI	CTAG	1 cut(s)	129
MalI	GATC	1 cut(s)	192
MboI	GATC	1 cut(s)	190
MboII	GAAGA	7 cut(s)	100, 275, 304, 307, 310, 313, 316
MluCI	AATT	1 cut(s)	116
MlyI	GAGTC	1 cut(s)	134
MmeI	TCCRAC	1 cut(s)	205
MnlI	CCTC	7 cut(s)	43, 48, 206, 247, 262, 280, 309
MspI	CCGG	1 cut(s)	199
MspR9I	CCNGG	1 cut(s)	134
MvaI	CCWGG	1 cut(s)	134
MwoI	GCNNNNNNNGC	2 cut(s)	107, 208
NdeII	GATC	1 cut(s)	190
NlaIII	CATG	1 cut(s)	26
NlaIV	GGNNCC	1 cut(s)	151
NmeAIII	GCCGAG	1 cut(s)	120
PaqCI	CACCTGC	1 cut(s)	161
PcsI	WCGNNNNNNNCGW	1 cut(s)	120
PfeI	GAWTC	2 cut(s)	67, 183
PleI	GAGTC	1 cut(s)	133
PpsI	GAGTC	1 cut(s)	133
Psp6I	CCWGG	1 cut(s)	132
PspGI	CCWGG	1 cut(s)	132
PspN4I	GGNNCC	1 cut(s)	151
PspPI	GGNCC	1 cut(s)	19
Sau3AI	GATC	1 cut(s)	190
Sau96I	GGNCC	1 cut(s)	19
SchI	GAGTC	1 cut(s)	134
ScrFI	CCNGG	1 cut(s)	134
SetI	ASST	6 cut(s)	10, 155, 213, 239, 291, 320
SfaNI	GCATC	1 cut(s)	153
SinI	GGWCC	1 cut(s)	19
Sse9I	AATT	1 cut(s)	116
SspMI	CTAG	1 cut(s)	129
StyD4I	CCNGG	1 cut(s)	132
TaqI	TCGA	3 cut(s)	114, 123, 181
TasI	AATT	1 cut(s)	116
TfiI	GAWTC	2 cut(s)	67, 183
VpaK11BI	GGWCC	1 cut(s)	19
XagI	CCTNNNNNAGG	1 cut(s)	200
XapI	RAATTY	1 cut(s)	116
XcmI	CCANNNNNNNNNTGG	1 cut(s)	221
XspI	CTAG	1 cut(s)	129

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.