Rmu_ssc0000213.1_g000049

TMV resistance protein N-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000213.1
OG0030374
Physical Location & Seq
Forward (+)
195813 .. 196397
585 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000213.1_g000049.1.cds

Sequence Viewer

Length: 585 bp
atggatccatccccttcctctcgagaactcggatccgtgagacccgaaccaaagagttatgtttttcctctttttatccctactcccacaactctttttacccctactcccacaattctttttacccctactcccacaactcgatggaagaatgatgttttcctctgtttcagaggtgaagacatcccaaagagttttacagagcatctgcttcgagctttggatcagaaaggaatatcgacagttcgaggtgagcctggggaaccaatccgtccaagtgacttcaaaccaattgaggaatcaatatgtgcaattgtcattttttcacccaactttgccaattcaacttggtgtttggatgggcttgcaaaggccgttgaatgcatgagaaagccggagggaatagccccagttttctatgatgtagatgacggtgacgtgaaaaatcaaaggggctcttttggggaagctttctcccagcttgaacaacgcttcaaagccgatccgaagaggatcggaaaatggagatctgcacttaaatccgtaggccatgtcagtgggtggtatccacgaaaatccaggtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LRR_3 NB-ARC TIR

Protein Analysis

194

Amino Acids

21.81

Weight (kDa)

8.91

Isoelectric Point (pI)

43.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0030374)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr6g0255131
rosa_multiflora Rmu_ssc0000213.1_g000049

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 6 cut(s) 12, 27, 40, 231, 497, 521
AgsI TTSAA 5 cut(s) 286, 345, 380, 485, 496
AjiI CACGTC 1 cut(s) 439
AjnI CCWGG 2 cut(s) 256, 578
AluBI AGCT 3 cut(s) 218, 470, 481
AluI AGCT 3 cut(s) 218, 470, 481
Alw26I GTCTC 1 cut(s) 34
AlwI GGATC 6 cut(s) 12, 27, 40, 231, 497, 521
Ama87I CYCGRG 1 cut(s) 21
AoxI GGCC 2 cut(s) 372, 547
AsuHPI GGTGA 4 cut(s) 188, 263, 318, 446
AvaI CYCGRG 1 cut(s) 21
BamHI GGATCC 2 cut(s) 4, 32
BanII GRGCYC 1 cut(s) 458
BbsI GAAGAC 1 cut(s) 186
BccI CCATC 3 cut(s) 16, 138, 353
BceAI ACGGC 1 cut(s) 359
BcgI CGANNNNNNTGC 2 cut(s) 194, 228
BciT130I CCWGG 2 cut(s) 258, 580
BciVI GTATCC 1 cut(s) 576
BcoDI GTCTC 1 cut(s) 34
BfuI GTATCC 1 cut(s) 576
BglII AGATCT 1 cut(s) 527
Bme1390I CCNGG 2 cut(s) 258, 580
BmeT110I CYCGRG 1 cut(s) 21
BmgBI CACGTC 1 cut(s) 439
BmiI GGNNCC 3 cut(s) 6, 34, 264
BmrFI CCNGG 2 cut(s) 258, 580
BmrI ACTGGG 1 cut(s) 404
BmsI GCATC 1 cut(s) 214
BmuI ACTGGG 1 cut(s) 404
BpiI GAAGAC 1 cut(s) 186
BsaI GGTCTC 1 cut(s) 34
BsaJI CCNNGG 1 cut(s) 257
BsaXI ACNNNNNCTCC 4 cut(s) 91, 115, 121, 145
Bse1I ACTGG 1 cut(s) 410
BseBI CCWGG 2 cut(s) 258, 580
BseDI CCNNGG 1 cut(s) 257
BseGI GGATG 3 cut(s) 8, 183, 364
BseNI ACTGG 1 cut(s) 410
BseYI CCCAGC 1 cut(s) 477
BsgI GTGCAG 1 cut(s) 516
BshFI GGCC 2 cut(s) 374, 549
BsiHKCI CYCGRG 1 cut(s) 21
BsiSI CCGG 1 cut(s) 395
BsmAI GTCTC 1 cut(s) 34
BsmI GAATGC 1 cut(s) 386
BsnI GGCC 2 cut(s) 374, 549
Bso31I GGTCTC 1 cut(s) 34
BsoBI CYCGRG 1 cut(s) 21
Bsp1286I GDGCHC 1 cut(s) 458
Bsp143I GATC 6 cut(s) 4, 32, 223, 502, 513, 527
BspANI GGCC 2 cut(s) 374, 549
BspLI GGNNCC 3 cut(s) 6, 34, 264
BspPI GGATC 6 cut(s) 12, 27, 40, 231, 497, 521
BspTNI GGTCTC 1 cut(s) 34
BsrI ACTGG 1 cut(s) 410
BssECI CCNNGG 1 cut(s) 257
BssMI GATC 6 cut(s) 4, 32, 223, 502, 513, 527
Bst2UI CCWGG 2 cut(s) 258, 580
Bst4CI ACNGT 2 cut(s) 244, 434
Bst6I CTCTTC 1 cut(s) 503
BstC8I GCNNGC 1 cut(s) 366
BstF5I GGATG 3 cut(s) 8, 183, 364
BstKTI GATC 6 cut(s) 7, 35, 226, 505, 516, 530
BstMAI GTCTC 1 cut(s) 34
BstMBI GATC 6 cut(s) 4, 32, 223, 502, 513, 527
BstNI CCWGG 2 cut(s) 258, 580
BstSCI CCNGG 2 cut(s) 256, 578
BstV2I GAAGAC 1 cut(s) 186
BstX2I RGATCY 3 cut(s) 4, 32, 527
BstXI CCANNNNNNTGG 1 cut(s) 557
BstYI RGATCY 3 cut(s) 4, 32, 527
BsuI GTATCC 1 cut(s) 576
BsuRI GGCC 2 cut(s) 374, 549
BtrI CACGTC 1 cut(s) 439
BtsCI GGATG 3 cut(s) 8, 183, 364
BtsIMutI CAGTG 1 cut(s) 562
Cac8I GCNNGC 1 cut(s) 366
CviAII CATG 2 cut(s) 385, 551
DpnI GATC 6 cut(s) 6, 34, 225, 504, 515, 529
DpnII GATC 6 cut(s) 4, 32, 223, 502, 513, 527
Eam1104I CTCTTC 1 cut(s) 503
EarI CTCTTC 1 cut(s) 503
Eco24I GRGCYC 1 cut(s) 458
Eco31I GGTCTC 1 cut(s) 34
Eco88I CYCGRG 1 cut(s) 21
EcoRII CCWGG 2 cut(s) 256, 578
EcoT22I ATGCAT 1 cut(s) 386
EcoT38I GRGCYC 1 cut(s) 458
FaeI CATG 2 cut(s) 388, 554
FaiI YATR 5 cut(s) 60, 307, 386, 420, 552
FalI AAGNNNNNCTT 2 cut(s) 442, 474
FatI CATG 2 cut(s) 384, 550
FokI GGATG 2 cut(s) 170, 371
FriOI GRGCYC 1 cut(s) 458
GsaI CCCAGC 1 cut(s) 481
HaeIII GGCC 2 cut(s) 374, 549
HapII CCGG 1 cut(s) 395
Hin1II CATG 2 cut(s) 388, 554
HindIII AAGCTT 1 cut(s) 468
HinfI GANTC 1 cut(s) 299
HpaII CCGG 1 cut(s) 395
HphI GGTGA 4 cut(s) 188, 263, 318, 446
Hpy188I TCNGA 5 cut(s) 32, 173, 228, 507, 518
Hpy188III TCNNGA 2 cut(s) 21, 23
HpyAV CCTTC 1 cut(s) 24
HpyCH4III ACNGT 2 cut(s) 244, 434
HpyCH4IV ACGT 1 cut(s) 438
HpyCH4V TGCA 4 cut(s) 311, 368, 384, 533
HpySE526I ACGT 1 cut(s) 438
Hsp92II CATG 2 cut(s) 388, 554
Kzo9I GATC 6 cut(s) 4, 32, 223, 502, 513, 527
LpnPI CCDG 6 cut(s) 243, 270, 408, 423, 491, 565
LweI GCATC 1 cut(s) 214
MaeII ACGT 1 cut(s) 438
MaeIII GTNAC 2 cut(s) 278, 434
MalI GATC 6 cut(s) 6, 34, 225, 504, 515, 529
MboI GATC 6 cut(s) 4, 32, 223, 502, 513, 527
MboII GAAGA 3 cut(s) 160, 191, 520
MfeI CAATTG 2 cut(s) 291, 312
MflI RGATCY 3 cut(s) 4, 32, 527
MhlI GDGCHC 1 cut(s) 458
MluCI AATT 4 cut(s) 114, 291, 312, 340
MnlI CCTC 8 cut(s) 28, 78, 167, 173, 242, 289, 391, 504
Mph1103I ATGCAT 1 cut(s) 386
MseI TTAA 1 cut(s) 537
MslI CAYNNNNRTG 1 cut(s) 555
MspI CCGG 1 cut(s) 395
MspR9I CCNGG 2 cut(s) 258, 580
MunI CAATTG 2 cut(s) 291, 312
Mva1269I GAATGC 1 cut(s) 386
MvaI CCWGG 2 cut(s) 258, 580
NdeII GATC 6 cut(s) 4, 32, 223, 502, 513, 527
NlaIII CATG 2 cut(s) 388, 554
NlaIV GGNNCC 3 cut(s) 6, 34, 264
NmuCI GTSAC 2 cut(s) 278, 434
NsiI ATGCAT 1 cut(s) 386
PaeR7I CTCGAG 1 cut(s) 21
PctI GAATGC 1 cut(s) 386
PfeI GAWTC 1 cut(s) 299
Psp6I CCWGG 2 cut(s) 256, 578
PspFI CCCAGC 1 cut(s) 477
PspGI CCWGG 2 cut(s) 256, 578
PspN4I GGNNCC 3 cut(s) 6, 34, 264
PsuI RGATCY 3 cut(s) 4, 32, 527
RseI CAYNNNNRTG 1 cut(s) 555
SaqAI TTAA 1 cut(s) 537
Sau3AI GATC 6 cut(s) 4, 32, 223, 502, 513, 527
ScrFI CCNGG 2 cut(s) 258, 580
SduI GDGCHC 1 cut(s) 458
SetI ASST 7 cut(s) 178, 220, 253, 441, 472, 483, 584
SfaNI GCATC 1 cut(s) 214
Sfr274I CTCGAG 1 cut(s) 21
SlaI CTCGAG 1 cut(s) 21
SmiMI CAYNNNNRTG 1 cut(s) 555
SmlI CTYRAG 1 cut(s) 21
SmoI CTYRAG 1 cut(s) 21
Sse9I AATT 4 cut(s) 114, 291, 312, 340
StyD4I CCNGG 2 cut(s) 256, 578
TaaI ACNGT 2 cut(s) 244, 434
TaiI ACGT 1 cut(s) 441
TaqI TCGA 5 cut(s) 22, 142, 214, 239, 247
TasI AATT 4 cut(s) 114, 291, 312, 340
TfiI GAWTC 1 cut(s) 299
Tru1I TTAA 1 cut(s) 537
Tru9I TTAA 1 cut(s) 537
TscAI CASTG 1 cut(s) 562
TseFI GTSAC 2 cut(s) 278, 434
Tsp45I GTSAC 2 cut(s) 278, 434
TspGWI ACGGA 3 cut(s) 25, 260, 532
TspRI CASTG 1 cut(s) 562
XhoI CTCGAG 1 cut(s) 21
Zsp2I ATGCAT 1 cut(s) 386
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.