Rmu_ssc0000286.1_g000023

Heterogeneous nuclear ribonucleoprotein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000286.1
OG0031017
Physical Location & Seq
Forward (+)
154998 .. 157775
2778 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000286.1_g000023.1.cds

Sequence Viewer

Length: 441 bp
atgggttcaggaagtgggaccattggaggaagcacatttggcaatactggggttaactggcggtcttcggcaatttcacctcaaggtggaggaaataatgtttctaacaatagtgggaatcttggttatggagccggtgataacacttatggtttgggaacgggagggtatggaaggaacagtggtacaagtgtaggccctgcgtcttcattcaatgcatcaaatggtggttttgatggagccttcaatgacttttacagtagtggttcagtttatggagatcccacttggcgatcctcaaattccgagcgagatgggcctggaccctttggttatggacttggcagtgcagcttctgacgtttcagctaaaagttctcctggttatgttggtggatatagtgttaataagagacagtcaaatacaggaattgctgcctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0003674 GO:0003676 GO:0003723 GO:0005488 GO:0097159 GO:1901363
KEGG Pathways
Metabolic & Signaling
ko03015 map03015
Pfam Domains
Protein Families
RRM_1

Protein Analysis

146

Amino Acids

14.27

Weight (kDa)

6.01

Isoelectric Point (pI)

32.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031017)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0036728.1_g000001 Rmu_ssc0000286.1_g000023

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 61
AclWI GGATC 2 cut(s) 275, 288
AcsI RAATTY 1 cut(s) 301
AfaI GTAC 1 cut(s) 187
AfiI CCNNNNNNNGG 1 cut(s) 86
AgsI TTSAA 2 cut(s) 214, 247
AjnI CCWGG 2 cut(s) 319, 379
AluBI AGCT 2 cut(s) 353, 368
AluI AGCT 2 cut(s) 353, 368
Alw26I GTCTC 1 cut(s) 406
AlwI GGATC 2 cut(s) 275, 288
AlwNI CAGNNNCTG 1 cut(s) 356
AoxI GGCC 2 cut(s) 196, 317
ApeKI GCWGC 2 cut(s) 350, 434
ApoI RAATTY 1 cut(s) 301
AspS9I GGNCC 4 cut(s) 18, 197, 317, 323
AsuHPI GGTGA 2 cut(s) 69, 149
AvaII GGWCC 2 cut(s) 18, 323
BaeI ACNNNNGTAYC 2 cut(s) 177, 210
BbsI GAAGAC 2 cut(s) 57, 198
BbvI GCAGC 2 cut(s) 362, 421
BccI CCATC 2 cut(s) 230, 308
BciT130I CCWGG 2 cut(s) 321, 381
BcoDI GTCTC 1 cut(s) 406
BfaI CTAG 1 cut(s) 439
BisI GCNGC 2 cut(s) 351, 435
BlsI GCNGC 2 cut(s) 352, 436
Bme1390I CCNGG 2 cut(s) 321, 381
Bme18I GGWCC 2 cut(s) 18, 323
BmgT120I GGNCC 4 cut(s) 18, 197, 317, 323
BmiI GGNNCC 4 cut(s) 19, 133, 241, 325
BmrFI CCNGG 2 cut(s) 321, 381
BmrI ACTGGG 1 cut(s) 57
BmsI GCATC 1 cut(s) 227
BmuI ACTGGG 1 cut(s) 57
BpiI GAAGAC 2 cut(s) 57, 198
BpuEI CTTGAG 1 cut(s) 66
Bsc4I CCNNNNNNNGG 1 cut(s) 86
Bse118I RCCGGY 1 cut(s) 134
Bse1I ACTGG 2 cut(s) 52, 62
BseBI CCWGG 2 cut(s) 321, 381
BseLI CCNNNNNNNGG 1 cut(s) 86
BseNI ACTGG 2 cut(s) 52, 62
BseXI GCAGC 2 cut(s) 362, 421
BsgI GTGCAG 1 cut(s) 369
BshFI GGCC 2 cut(s) 198, 319
BsiSI CCGG 1 cut(s) 135
BslFI GGGAC 1 cut(s) 31
BslI CCNNNNNNNGG 1 cut(s) 86
BsmAI GTCTC 1 cut(s) 406
BsmFI GGGAC 1 cut(s) 31
BsnI GGCC 2 cut(s) 198, 319
Bsp143I GATC 2 cut(s) 280, 293
BspACI CCGC 1 cut(s) 61
BspANI GGCC 2 cut(s) 198, 319
BspLI GGNNCC 4 cut(s) 19, 133, 241, 325
BspPI GGATC 2 cut(s) 275, 288
BsrFI RCCGGY 1 cut(s) 134
BsrI ACTGG 2 cut(s) 52, 62
BssAI RCCGGY 1 cut(s) 134
BssMI GATC 2 cut(s) 280, 293
Bst2UI CCWGG 2 cut(s) 321, 381
Bst4CI ACNGT 3 cut(s) 182, 260, 417
BstKTI GATC 2 cut(s) 283, 296
BstMAI GTCTC 1 cut(s) 406
BstMBI GATC 2 cut(s) 280, 293
BstMWI GCNNNNNNNGC 2 cut(s) 39, 316
BstNI CCWGG 2 cut(s) 321, 381
BstSCI CCNGG 2 cut(s) 319, 379
BstV1I GCAGC 2 cut(s) 362, 421
BstV2I GAAGAC 2 cut(s) 57, 198
BstX2I RGATCY 1 cut(s) 280
BstYI RGATCY 1 cut(s) 280
BsuRI GGCC 2 cut(s) 198, 319
BtsI GCAGTG 1 cut(s) 352
BtsIMutI CAGTG 2 cut(s) 187, 352
CaiI CAGNNNCTG 1 cut(s) 356
Cfr10I RCCGGY 1 cut(s) 134
Cfr13I GGNCC 4 cut(s) 18, 197, 317, 323
CseI GACGC 1 cut(s) 192
Csp6I GTAC 1 cut(s) 186
CviJI RGCY 6 cut(s) 134, 198, 242, 319, 353, 368
CviKI_1 RGCY 6 cut(s) 134, 198, 242, 319, 353, 368
CviQI GTAC 1 cut(s) 186
DpnI GATC 2 cut(s) 282, 295
DpnII GATC 2 cut(s) 280, 293
Eco47I GGWCC 2 cut(s) 18, 323
EcoO109I RGGNCCY 1 cut(s) 197
EcoRII CCWGG 2 cut(s) 319, 379
EcoT22I ATGCAT 1 cut(s) 220
FaiI YATR 7 cut(s) 129, 150, 171, 276, 336, 387, 399
FaqI GGGAC 1 cut(s) 31
Fnu4HI GCNGC 2 cut(s) 351, 435
Fsp4HI GCNGC 2 cut(s) 351, 435
FspBI CTAG 1 cut(s) 439
GluI GCNGC 2 cut(s) 351, 435
HaeIII GGCC 2 cut(s) 198, 319
HapII CCGG 1 cut(s) 135
HgaI GACGC 1 cut(s) 192
HincII GTYRAC 1 cut(s) 55
HindII GTYRAC 1 cut(s) 55
HinfI GANTC 1 cut(s) 118
HpaI GTTAAC 1 cut(s) 55
HpaII CCGG 1 cut(s) 135
HphI GGTGA 2 cut(s) 69, 149
Hpy166II GTNNAC 1 cut(s) 55
Hpy188I TCNGA 2 cut(s) 307, 358
Hpy188III TCNNGA 1 cut(s) 9
Hpy8I GTNNAC 1 cut(s) 55
HpyAV CCTTC 2 cut(s) 168, 253
HpyCH4III ACNGT 3 cut(s) 182, 260, 417
HpyCH4IV ACGT 1 cut(s) 360
HpyCH4V TGCA 2 cut(s) 218, 350
HpyF10VI GCNNNNNNNGC 2 cut(s) 39, 316
HpySE526I ACGT 1 cut(s) 360
KspAI GTTAAC 1 cut(s) 55
Kzo9I GATC 2 cut(s) 280, 293
LmnI GCTCC 2 cut(s) 131, 239
LpnPI CCDG 9 cut(s) 33, 43, 148, 213, 306, 333, 366, 393, 411
Lsp1109I GCAGC 2 cut(s) 362, 421
LweI GCATC 1 cut(s) 227
MaeI CTAG 1 cut(s) 439
MaeII ACGT 1 cut(s) 360
MalI GATC 2 cut(s) 282, 295
MboI GATC 2 cut(s) 280, 293
MboII GAAGA 2 cut(s) 57, 198
MflI RGATCY 1 cut(s) 280
MluCI AATT 3 cut(s) 72, 301, 429
MnlI CCTC 5 cut(s) 20, 83, 90, 158, 307
Mph1103I ATGCAT 1 cut(s) 220
MseI TTAA 2 cut(s) 54, 405
MspI CCGG 1 cut(s) 135
MspR9I CCNGG 2 cut(s) 321, 381
MvaI CCWGG 2 cut(s) 321, 381
MwoI GCNNNNNNNGC 2 cut(s) 39, 316
NdeII GATC 2 cut(s) 280, 293
NlaIV GGNNCC 4 cut(s) 19, 133, 241, 325
NsiI ATGCAT 1 cut(s) 220
PfeI GAWTC 1 cut(s) 118
PkrI GCNGC 2 cut(s) 352, 436
Psp6I CCWGG 2 cut(s) 319, 379
PspGI CCWGG 2 cut(s) 319, 379
PspN4I GGNNCC 4 cut(s) 19, 133, 241, 325
PspPI GGNCC 4 cut(s) 18, 197, 317, 323
PstNI CAGNNNCTG 1 cut(s) 356
PsuI RGATCY 1 cut(s) 280
RsaI GTAC 1 cut(s) 187
RsaNI GTAC 1 cut(s) 186
SaqAI TTAA 2 cut(s) 54, 405
SatI GCNGC 2 cut(s) 351, 435
Sau3AI GATC 2 cut(s) 280, 293
Sau96I GGNCC 4 cut(s) 18, 197, 317, 323
ScrFI CCNGG 2 cut(s) 321, 381
SetI ASST 5 cut(s) 82, 88, 355, 363, 370
SfaNI GCATC 1 cut(s) 227
SinI GGWCC 2 cut(s) 18, 323
SmlI CTYRAG 1 cut(s) 81
SmoI CTYRAG 1 cut(s) 81
Sse9I AATT 3 cut(s) 72, 301, 429
SsiI CCGC 1 cut(s) 61
SspMI CTAG 1 cut(s) 439
StyD4I CCNGG 2 cut(s) 319, 379
TaaI ACNGT 3 cut(s) 182, 260, 417
TaiI ACGT 1 cut(s) 363
TasI AATT 3 cut(s) 72, 301, 429
TfiI GAWTC 1 cut(s) 118
Tru1I TTAA 2 cut(s) 54, 405
Tru9I TTAA 2 cut(s) 54, 405
TscAI CASTG 2 cut(s) 187, 352
TseI GCWGC 2 cut(s) 350, 434
TspDTI ATGAA 1 cut(s) 198
TspRI CASTG 2 cut(s) 187, 352
VpaK11BI GGWCC 2 cut(s) 18, 323
XapI RAATTY 1 cut(s) 301
XspI CTAG 1 cut(s) 439
Zsp2I ATGCAT 1 cut(s) 220
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.