Rmu_ssc0000424.1_g000001

Cryptochrome DASH

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000424.1
OG0027751
Physical Location & Seq
Forward (+)
466 .. 1515
1050 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000424.1_g000001.1.cds

Sequence Viewer

Length: 414 bp
atgtcaaatcggggaagacagattgtatgttcctttttggttcgagatatgggtattgactggcgcatgggagctgaatggtttgagacatgccttttggattatgacccctgttccaattatggtaattggacctatggagcaggagttggaaatgaccccagggaagatcgttacttcagcattccgaaacaagcccagaattatgatcctgaaggcgagtatgtagcttactggcttccacagctacaatcacttccaaaagataaaaggcacttccctggaatggcatatatcaagcaggttgtccctctcaagtttggtaatgccggtaagtatcaaaaccacgacaagacctcgactgccagaggcaaaaactttggaggaagacaagcaaaagggtccaggagatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DNA_photolyase FAD_binding_7

Protein Analysis

137

Amino Acids

15.77

Weight (kDa)

9.3

Isoelectric Point (pI)

30.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0027751)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g30530
rosa_multiflora Rmu_ssc0000424.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 292
AclWI GGATC 1 cut(s) 203
AcuI CTGAAG 2 cut(s) 163, 234
AfiI CCNNNNNNNGG 1 cut(s) 286
AjnI CCWGG 3 cut(s) 161, 280, 404
AluBI AGCT 3 cut(s) 74, 230, 247
AluI AGCT 3 cut(s) 74, 230, 247
Alw26I GTCTC 1 cut(s) 80
AlwI GGATC 1 cut(s) 203
ArsI GACNNNNNNTTYG 2 cut(s) 79, 111
AspLEI GCGC 1 cut(s) 66
AspS9I GGNCC 2 cut(s) 132, 402
AvaII GGWCC 2 cut(s) 132, 402
BbsI GAAGAC 2 cut(s) 22, 394
BciT130I CCWGG 3 cut(s) 163, 282, 406
BcoDI GTCTC 1 cut(s) 80
BfuAI ACCTGC 1 cut(s) 292
Bme1390I CCNGG 3 cut(s) 163, 282, 406
Bme18I GGWCC 2 cut(s) 132, 402
BmgT120I GGNCC 2 cut(s) 132, 402
BmiI GGNNCC 1 cut(s) 403
BmrFI CCNGG 3 cut(s) 163, 282, 406
BpiI GAAGAC 2 cut(s) 22, 394
BpuEI CTTGAG 1 cut(s) 299
BsaJI CCNNGG 3 cut(s) 161, 162, 280
BsaXI ACNNNNNCTCC 2 cut(s) 132, 162
Bsc4I CCNNNNNNNGG 1 cut(s) 286
Bse118I RCCGGY 1 cut(s) 329
Bse1I ACTGG 2 cut(s) 65, 239
BseBI CCWGG 3 cut(s) 163, 282, 406
BseDI CCNNGG 3 cut(s) 161, 162, 280
BseLI CCNNNNNNNGG 1 cut(s) 286
BseNI ACTGG 2 cut(s) 65, 239
BsiSI CCGG 1 cut(s) 330
BslFI GGGAC 1 cut(s) 293
BslI CCNNNNNNNGG 1 cut(s) 286
BsmAI GTCTC 1 cut(s) 80
BsmFI GGGAC 1 cut(s) 293
BsmI GAATGC 1 cut(s) 183
Bsp143I GATC 2 cut(s) 169, 208
BspLI GGNNCC 1 cut(s) 403
BspMI ACCTGC 1 cut(s) 292
BspPI GGATC 1 cut(s) 203
BsrFI RCCGGY 1 cut(s) 329
BsrI ACTGG 2 cut(s) 65, 239
BssAI RCCGGY 1 cut(s) 329
BssECI CCNNGG 3 cut(s) 161, 162, 280
BssMI GATC 2 cut(s) 169, 208
Bst2UI CCWGG 3 cut(s) 163, 282, 406
BstHHI GCGC 1 cut(s) 66
BstKTI GATC 2 cut(s) 172, 211
BstMAI GTCTC 1 cut(s) 80
BstMBI GATC 2 cut(s) 169, 208
BstMWI GCNNNNNNNGC 1 cut(s) 244
BstNI CCWGG 3 cut(s) 163, 282, 406
BstNSI RCATGY 1 cut(s) 93
BstSCI CCNGG 3 cut(s) 161, 280, 404
BstV2I GAAGAC 2 cut(s) 22, 394
BveI ACCTGC 1 cut(s) 292
CfoI GCGC 1 cut(s) 66
Cfr10I RCCGGY 1 cut(s) 329
Cfr13I GGNCC 2 cut(s) 132, 402
CviAII CATG 2 cut(s) 67, 90
CviJI RGCY 5 cut(s) 74, 197, 230, 238, 247
CviKI_1 RGCY 5 cut(s) 74, 197, 230, 238, 247
DpnI GATC 2 cut(s) 171, 210
DpnII GATC 2 cut(s) 169, 208
Eco47I GGWCC 2 cut(s) 132, 402
Eco57I CTGAAG 2 cut(s) 163, 234
EcoRII CCWGG 3 cut(s) 161, 280, 404
FaeI CATG 2 cut(s) 70, 93
FaqI GGGAC 1 cut(s) 293
FatI CATG 2 cut(s) 66, 89
GlaI GCGC 1 cut(s) 65
HapII CCGG 1 cut(s) 330
HhaI GCGC 1 cut(s) 66
Hin1II CATG 2 cut(s) 70, 93
Hin6I GCGC 1 cut(s) 64
HinP1I GCGC 1 cut(s) 64
HpaII CCGG 1 cut(s) 330
Hpy188I TCNGA 1 cut(s) 189
Hpy188III TCNNGA 2 cut(s) 44, 212
HpyAV CCTTC 1 cut(s) 209
HpyF10VI GCNNNNNNNGC 1 cut(s) 244
Hsp92II CATG 2 cut(s) 70, 93
HspAI GCGC 1 cut(s) 64
Kzo9I GATC 2 cut(s) 169, 208
LmnI GCTCC 2 cut(s) 71, 140
MaeIII GTNAC 1 cut(s) 173
MalI GATC 2 cut(s) 171, 210
MboI GATC 2 cut(s) 169, 208
MboII GAAGA 3 cut(s) 27, 179, 399
MluCI AATT 3 cut(s) 118, 127, 202
MmeI TCCRAC 1 cut(s) 130
MnlI CCTC 4 cut(s) 321, 362, 367, 377
MspI CCGG 1 cut(s) 330
MspR9I CCNGG 3 cut(s) 163, 282, 406
Mva1269I GAATGC 1 cut(s) 183
MvaI CCWGG 3 cut(s) 163, 282, 406
MwoI GCNNNNNNNGC 1 cut(s) 244
NdeII GATC 2 cut(s) 169, 208
NlaIII CATG 2 cut(s) 70, 93
NlaIV GGNNCC 1 cut(s) 403
NspI RCATGY 1 cut(s) 93
PasI CCCWGGG 1 cut(s) 162
PctI GAATGC 1 cut(s) 183
PfoI TCCNGGA 1 cut(s) 404
Psp6I CCWGG 3 cut(s) 161, 280, 404
PspGI CCWGG 3 cut(s) 161, 280, 404
PspN4I GGNNCC 1 cut(s) 403
PspPI GGNCC 2 cut(s) 132, 402
Sau3AI GATC 2 cut(s) 169, 208
Sau96I GGNCC 2 cut(s) 132, 402
ScrFI CCNGG 3 cut(s) 163, 282, 406
SetI ASST 6 cut(s) 76, 137, 232, 249, 306, 359
SinI GGWCC 2 cut(s) 132, 402
SmlI CTYRAG 1 cut(s) 314
SmoI CTYRAG 1 cut(s) 314
Sse9I AATT 3 cut(s) 118, 127, 202
StyD4I CCNGG 3 cut(s) 161, 280, 404
TaqI TCGA 2 cut(s) 43, 359
TasI AATT 3 cut(s) 118, 127, 202
VpaK11BI GGWCC 2 cut(s) 132, 402
XceI RCATGY 1 cut(s) 93
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.