Rroxscaffold_1G00011230

LRR-repeat protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
14230640 .. 14231190
551 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00011230.1

Sequence Viewer

Length: 306 bp
ATGAAGGGGATTCACAAATTTCAAGAGGTTCAGATAGTTGCCAGATTATGGTATTTGGAGTTAGTCTCACATTATTTTTCTTACTGGGGTGACTTCCTAGATGACTATTCCTTTTATAACTCATCCGCAAGTGAAGCTCATGTATCTCTTAATTCTATGAGGGTCAGACATGTTAGTTATCGGTTGTATAAGCTCCGTAGAGGCCTTTCTAATGTGATGGACCTAACTATCTGTTATACTTCCTTTGAGGTGGTTCAGACCAATGCTCCAGAACTTCTTGCCAGATGCCCTTGTTCTATAATCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

101

Amino Acids

11.88

Weight (kDa)

7.75

Isoelectric Point (pI)

30.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0031715)

Species Orthologous Gene IDs
rosa_roxburghii Rroxscaffold_1G00011230
rosa_samantha Rh5CG499700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 117
AccB7I CCANNNNNTGG 1 cut(s) 48
AciI CCGC 1 cut(s) 126
AcsI RAATTY 1 cut(s) 17
AfiI CCNNNNNNNGG 1 cut(s) 48
AflIII ACRYGT 1 cut(s) 169
AgsI TTSAA 1 cut(s) 23
AluBI AGCT 2 cut(s) 137, 193
AluI AGCT 2 cut(s) 137, 193
Alw26I GTCTC 1 cut(s) 70
AoxI GGCC 1 cut(s) 202
ApoI RAATTY 1 cut(s) 17
AspS9I GGNCC 1 cut(s) 220
AsuHPI GGTGA 1 cut(s) 101
AvaII GGWCC 1 cut(s) 220
BccI CCATC 1 cut(s) 211
BcoDI GTCTC 1 cut(s) 70
BfaI CTAG 1 cut(s) 98
Bme18I GGWCC 1 cut(s) 220
BmgT120I GGNCC 1 cut(s) 220
BmrI ACTGGG 1 cut(s) 94
BmsI GCATC 1 cut(s) 275
BmuI ACTGGG 1 cut(s) 94
BplI GAGNNNNNCTC 2 cut(s) 50, 82
BpmI CTGGAG 1 cut(s) 252
BsaXI ACNNNNNCTCC 2 cut(s) 250, 280
Bsc4I CCNNNNNNNGG 1 cut(s) 48
Bse1I ACTGG 1 cut(s) 89
BseGI GGATG 1 cut(s) 122
BseLI CCNNNNNNNGG 1 cut(s) 48
BseNI ACTGG 1 cut(s) 89
BshFI GGCC 1 cut(s) 204
BslI CCNNNNNNNGG 1 cut(s) 48
BsmAI GTCTC 1 cut(s) 70
BsnI GGCC 1 cut(s) 204
BspACI CCGC 1 cut(s) 126
BspANI GGCC 1 cut(s) 204
BsrI ACTGG 1 cut(s) 89
BstF5I GGATG 1 cut(s) 122
BstMAI GTCTC 1 cut(s) 70
BstMWI GCNNNNNNNGC 1 cut(s) 134
BstNSI RCATGY 1 cut(s) 173
BsuRI GGCC 1 cut(s) 204
BtsCI GGATG 1 cut(s) 122
Cfr13I GGNCC 1 cut(s) 220
CviAII CATG 2 cut(s) 140, 170
CviJI RGCY 3 cut(s) 137, 193, 204
CviKI_1 RGCY 3 cut(s) 137, 193, 204
Eco147I AGGCCT 1 cut(s) 204
Eco47I GGWCC 1 cut(s) 220
FaeI CATG 2 cut(s) 143, 173
FaiI YATR 8 cut(s) 49, 117, 141, 158, 171, 189, 237, 299
FatI CATG 2 cut(s) 139, 169
FokI GGATG 1 cut(s) 109
FspBI CTAG 1 cut(s) 98
GsuI CTGGAG 1 cut(s) 252
HaeIII GGCC 1 cut(s) 204
Hin1II CATG 2 cut(s) 143, 173
HinfI GANTC 1 cut(s) 10
HphI GGTGA 1 cut(s) 101
Hpy188I TCNGA 3 cut(s) 33, 167, 258
Hpy188III TCNNGA 2 cut(s) 23, 269
HpyF10VI GCNNNNNNNGC 1 cut(s) 134
Hsp92II CATG 2 cut(s) 143, 173
LmnI GCTCC 2 cut(s) 198, 271
LpnPI CCDG 4 cut(s) 55, 70, 282, 295
LweI GCATC 1 cut(s) 275
MaeI CTAG 1 cut(s) 98
MaeIII GTNAC 1 cut(s) 89
MluCI AATT 2 cut(s) 17, 151
MnlI CCTC 4 cut(s) 19, 153, 194, 241
MseI TTAA 1 cut(s) 150
MwoI GCNNNNNNNGC 1 cut(s) 134
NlaIII CATG 2 cut(s) 143, 173
NmuCI GTSAC 1 cut(s) 89
NspI RCATGY 1 cut(s) 173
PceI AGGCCT 1 cut(s) 204
PciI ACATGT 1 cut(s) 169
PfeI GAWTC 1 cut(s) 10
PflMI CCANNNNNTGG 1 cut(s) 48
PscI ACATGT 1 cut(s) 169
PsiI TTATAA 1 cut(s) 117
PspPI GGNCC 1 cut(s) 220
SaqAI TTAA 1 cut(s) 150
Sau96I GGNCC 1 cut(s) 220
SetI ASST 5 cut(s) 30, 139, 195, 225, 252
SfaNI GCATC 1 cut(s) 275
SinI GGWCC 1 cut(s) 220
Sse9I AATT 2 cut(s) 17, 151
SseBI AGGCCT 1 cut(s) 204
SsiI CCGC 1 cut(s) 126
SspMI CTAG 1 cut(s) 98
StuI AGGCCT 1 cut(s) 204
TasI AATT 2 cut(s) 17, 151
TfiI GAWTC 1 cut(s) 10
Tru1I TTAA 1 cut(s) 150
Tru9I TTAA 1 cut(s) 150
TseFI GTSAC 1 cut(s) 89
Tsp45I GTSAC 1 cut(s) 89
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 185
Van91I CCANNNNNTGG 1 cut(s) 48
VpaK11BI GGWCC 1 cut(s) 220
XapI RAATTY 1 cut(s) 17
XceI RCATGY 1 cut(s) 173
XspI CTAG 1 cut(s) 98
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.