Rh5CG499700

LRR-repeat protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Forward (+)
69468205 .. 69468604
400 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG499700.1

Sequence Viewer

Length: 258 bp
ATGGTATTTGGAGTTAGTCTCACATATTTTTCTTACTGGGGTGAGTTCCTAGATGACTATTCCTTTTATAACTCATCTGCAAGTGAAGCTCATGTATCTCTTAATTCTCTGAGGGTCAGACATATTAGTTATCGGTTGTATAAGCTCCTTAGAGGCCTTTCTAATGTGATGGACCTAACTATCTGTTATACTTCCTTTGAGGTGGTTCAGACCAATGCTCCAGAACTTCTTGCCAGATGCCCTTGTTCTATAATCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

85

Amino Acids

9.77

Weight (kDa)

6.02

Isoelectric Point (pI)

24.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0031715)

Species Orthologous Gene IDs
rosa_roxburghii Rroxscaffold_1G00011230
rosa_samantha Rh5CG499700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 69
AluBI AGCT 2 cut(s) 89, 145
AluI AGCT 2 cut(s) 89, 145
Alw26I GTCTC 1 cut(s) 23
AoxI GGCC 1 cut(s) 154
AspS9I GGNCC 1 cut(s) 172
AsuHPI GGTGA 1 cut(s) 53
AvaII GGWCC 1 cut(s) 172
BccI CCATC 1 cut(s) 163
BcoDI GTCTC 1 cut(s) 23
BfaI CTAG 1 cut(s) 50
Bme18I GGWCC 1 cut(s) 172
BmgT120I GGNCC 1 cut(s) 172
BmrI ACTGGG 1 cut(s) 46
BmsI GCATC 1 cut(s) 227
BmuI ACTGGG 1 cut(s) 46
BplI GAGNNNNNCTC 1 cut(s) 35
BpmI CTGGAG 1 cut(s) 204
BsaXI ACNNNNNCTCC 2 cut(s) 202, 232
Bse1I ACTGG 1 cut(s) 41
BseMII CTCAG 1 cut(s) 101
BseNI ACTGG 1 cut(s) 41
BshFI GGCC 1 cut(s) 156
BsmAI GTCTC 1 cut(s) 23
BsnI GGCC 1 cut(s) 156
BspANI GGCC 1 cut(s) 156
BspCNI CTCAG 1 cut(s) 102
BsrI ACTGG 1 cut(s) 41
BstDEI CTNAG 2 cut(s) 110, 149
BstMAI GTCTC 1 cut(s) 23
BstMWI GCNNNNNNNGC 1 cut(s) 86
BsuRI GGCC 1 cut(s) 156
Cfr13I GGNCC 1 cut(s) 172
CviAII CATG 1 cut(s) 92
CviJI RGCY 3 cut(s) 89, 145, 156
CviKI_1 RGCY 3 cut(s) 89, 145, 156
DdeI CTNAG 2 cut(s) 110, 149
Eco147I AGGCCT 1 cut(s) 156
Eco47I GGWCC 1 cut(s) 172
FaeI CATG 1 cut(s) 95
FaiI YATR 7 cut(s) 25, 69, 93, 123, 141, 189, 251
FatI CATG 1 cut(s) 91
FspBI CTAG 1 cut(s) 50
GsuI CTGGAG 1 cut(s) 204
HaeIII GGCC 1 cut(s) 156
Hin1II CATG 1 cut(s) 95
HphI GGTGA 1 cut(s) 53
Hpy188I TCNGA 3 cut(s) 111, 119, 210
Hpy188III TCNNGA 1 cut(s) 221
HpyCH4V TGCA 1 cut(s) 80
HpyF10VI GCNNNNNNNGC 1 cut(s) 86
HpyF3I CTNAG 2 cut(s) 110, 149
Hsp92II CATG 1 cut(s) 95
LmnI GCTCC 2 cut(s) 150, 223
LpnPI CCDG 3 cut(s) 22, 234, 247
LweI GCATC 1 cut(s) 227
MaeI CTAG 1 cut(s) 50
MluCI AATT 1 cut(s) 103
MnlI CCTC 3 cut(s) 105, 146, 193
MseI TTAA 1 cut(s) 102
MwoI GCNNNNNNNGC 1 cut(s) 86
NlaIII CATG 1 cut(s) 95
PceI AGGCCT 1 cut(s) 156
PsiI TTATAA 1 cut(s) 69
PspPI GGNCC 1 cut(s) 172
SaqAI TTAA 1 cut(s) 102
Sau96I GGNCC 1 cut(s) 172
SetI ASST 4 cut(s) 91, 147, 177, 204
SfaNI GCATC 1 cut(s) 227
SgeI CNNG 7 cut(s) 49, 62, 93, 104, 233, 242, 246
SinI GGWCC 1 cut(s) 172
Sse9I AATT 1 cut(s) 103
SseBI AGGCCT 1 cut(s) 156
SspMI CTAG 1 cut(s) 50
StuI AGGCCT 1 cut(s) 156
TasI AATT 1 cut(s) 103
Tru1I TTAA 1 cut(s) 102
Tru9I TTAA 1 cut(s) 102
VpaK11BI GGWCC 1 cut(s) 172
XspI CTAG 1 cut(s) 50
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.