Rroxscaffold_1G00033770
ERF Family

Belongs to the protein kinase superfamily. Ser Thr protein kinase family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
48920846 .. 48924114
3269 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00033770.1

Sequence Viewer

Length: 177 bp
ATGAGTTGCAAGTTAGCTGGCCAGACTTTCATACAGCAATATTTCAAATCTTGTAATATTCTTCGGGATGATTACTTATACTCAAAAGTTTTGGATTTTGAGTTGGTTAAACTTGCTCTGGATGGGGACAGCTCTGTTGAAAGAGCTTTCAGAGATATTTGGATACCTTGCACCTGA

Protein Analysis

58

Amino Acids

6.76

Weight (kDa)

5.03

Isoelectric Point (pI)

48.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0025725)

Species Orthologous Gene IDs
rosa_roxburghii Rroxscaffold_1G00033770
rosa_samantha Rh5BG326300 Rh5CG352800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 19
AgsI TTSAA 2 cut(s) 46, 140
AluBI AGCT 3 cut(s) 17, 132, 146
AluI AGCT 3 cut(s) 17, 132, 146
AoxI GGCC 1 cut(s) 19
BalI TGGCCA 1 cut(s) 21
BccI CCATC 1 cut(s) 116
BciVI GTATCC 1 cut(s) 156
BfuI GTATCC 1 cut(s) 156
BseGI GGATG 2 cut(s) 73, 127
BshFI GGCC 1 cut(s) 21
BslFI GGGAC 1 cut(s) 140
BsmFI GGGAC 1 cut(s) 140
BsnI GGCC 1 cut(s) 21
BspANI GGCC 1 cut(s) 21
BstC8I GCNNGC 1 cut(s) 19
BstF5I GGATG 2 cut(s) 73, 127
BsuI GTATCC 1 cut(s) 156
BsuRI GGCC 1 cut(s) 21
BtsCI GGATG 2 cut(s) 73, 127
Cac8I GCNNGC 1 cut(s) 19
CviJI RGCY 4 cut(s) 17, 21, 132, 146
CviKI_1 RGCY 4 cut(s) 17, 21, 132, 146
EaeI YGGCCR 1 cut(s) 19
FaiI YATR 2 cut(s) 32, 79
FaqI GGGAC 1 cut(s) 140
FokI GGATG 2 cut(s) 80, 134
HaeIII GGCC 1 cut(s) 21
Hpy188I TCNGA 1 cut(s) 152
Hpy188III TCNNGA 2 cut(s) 65, 119
HpyCH4V TGCA 2 cut(s) 9, 171
LpnPI CCDG 3 cut(s) 3, 35, 104
MboII GAAGA 1 cut(s) 53
MlsI TGGCCA 1 cut(s) 21
MluNI TGGCCA 1 cut(s) 21
Mox20I TGGCCA 1 cut(s) 21
MscI TGGCCA 1 cut(s) 21
MseI TTAA 1 cut(s) 108
Msp20I TGGCCA 1 cut(s) 21
SaqAI TTAA 1 cut(s) 108
SetI ASST 5 cut(s) 19, 134, 148, 169, 176
SgeI CNNG 7 cut(s) 22, 30, 34, 63, 77, 125, 131
SspI AATATT 2 cut(s) 41, 58
Tru1I TTAA 1 cut(s) 108
Tru9I TTAA 1 cut(s) 108
TspDTI ATGAA 1 cut(s) 19
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.