Rh5CG352800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Reverse (-)
40923488 .. 40925801
2314 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG352800.1

Sequence Viewer

Length: 150 bp
ATGGGGACAGCTCTGTTGAAAGAGCTTTCAGAGATATTTGGATACCTTGCACCTGAATATACAACTGGTAATTTCCTTGACCAACAACTACTGGTGGAACCATGGCAACCCAGGATGTCTAGAAGATTTTTGAACATTCCAAATTTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

49

Amino Acids

5.75

Weight (kDa)

5.0

Isoelectric Point (pI)

51.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0025725)

Species Orthologous Gene IDs
rosa_roxburghii Rroxscaffold_1G00033770
rosa_samantha Rh5BG326300 Rh5CG352800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 142
AgsI TTSAA 2 cut(s) 19, 133
AjnI CCWGG 1 cut(s) 110
AluBI AGCT 2 cut(s) 11, 25
AluI AGCT 2 cut(s) 11, 25
ApoI RAATTY 1 cut(s) 142
BciT130I CCWGG 1 cut(s) 112
BciVI GTATCC 1 cut(s) 35
BfaI CTAG 1 cut(s) 120
BfuI GTATCC 1 cut(s) 35
Bme1390I CCNGG 1 cut(s) 112
BmiI GGNNCC 1 cut(s) 99
BmrFI CCNGG 1 cut(s) 112
BsaJI CCNNGG 2 cut(s) 101, 110
Bse1I ACTGG 2 cut(s) 70, 96
BseBI CCWGG 1 cut(s) 112
BseDI CCNNGG 2 cut(s) 101, 110
BseGI GGATG 1 cut(s) 120
BseNI ACTGG 2 cut(s) 70, 96
BslFI GGGAC 1 cut(s) 19
BsmFI GGGAC 1 cut(s) 19
Bsp19I CCATGG 1 cut(s) 101
BspLI GGNNCC 1 cut(s) 99
BsrI ACTGG 2 cut(s) 70, 96
BssECI CCNNGG 2 cut(s) 101, 110
BssT1I CCWWGG 1 cut(s) 101
Bst2UI CCWGG 1 cut(s) 112
BstDSI CCRYGG 1 cut(s) 101
BstF5I GGATG 1 cut(s) 120
BstNI CCWGG 1 cut(s) 112
BstSCI CCNGG 1 cut(s) 110
BsuI GTATCC 1 cut(s) 35
BtgI CCRYGG 1 cut(s) 101
BtsCI GGATG 1 cut(s) 120
CviAII CATG 1 cut(s) 102
CviJI RGCY 2 cut(s) 11, 25
CviKI_1 RGCY 2 cut(s) 11, 25
Eco130I CCWWGG 1 cut(s) 101
EcoRII CCWGG 1 cut(s) 110
EcoT14I CCWWGG 1 cut(s) 101
ErhI CCWWGG 1 cut(s) 101
FaeI CATG 1 cut(s) 105
FaiI YATR 2 cut(s) 60, 103
FaqI GGGAC 1 cut(s) 19
FatI CATG 1 cut(s) 101
FokI GGATG 1 cut(s) 127
FspBI CTAG 1 cut(s) 120
Hin1II CATG 1 cut(s) 105
Hpy188I TCNGA 1 cut(s) 31
Hpy188III TCNNGA 1 cut(s) 120
HpyCH4V TGCA 1 cut(s) 50
Hsp92II CATG 1 cut(s) 105
LpnPI CCDG 5 cut(s) 51, 66, 77, 97, 124
MaeI CTAG 1 cut(s) 120
MboII GAAGA 1 cut(s) 135
MluCI AATT 2 cut(s) 70, 142
MspR9I CCNGG 1 cut(s) 112
MvaI CCWGG 1 cut(s) 112
NcoI CCATGG 1 cut(s) 101
NlaIII CATG 1 cut(s) 105
NlaIV GGNNCC 1 cut(s) 99
Psp6I CCWGG 1 cut(s) 110
PspGI CCWGG 1 cut(s) 110
PspN4I GGNNCC 1 cut(s) 99
ScrFI CCNGG 1 cut(s) 112
SetI ASST 4 cut(s) 13, 27, 48, 55
SgeI CNNG 9 cut(s) 59, 65, 78, 89, 104, 114, 123, 124, 132
Sse9I AATT 2 cut(s) 70, 142
SspMI CTAG 1 cut(s) 120
StyD4I CCNGG 1 cut(s) 110
StyI CCWWGG 1 cut(s) 101
TasI AATT 2 cut(s) 70, 142
XapI RAATTY 1 cut(s) 142
XbaI TCTAGA 1 cut(s) 119
XspI CTAG 1 cut(s) 120
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.