Rroxscaffold_3G00246160

MOB kinase activator-like

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Forward (+)
39252375 .. 39258278
5904 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00246160.1

Sequence Viewer

Length: 186 bp
ATGACTGCAGGCCCCAAGTATGAGTATAGATGGGCAGATGGTGTACAAATTAAGAAACCTATTGAGGTTTCTGCTCCAAAATATGTTGAATATCTGATGGACTGGATTGAATCTCAACTTGATGATGAATCCATATTTCCTCAAAAGCTTGGCGCACCATTCCCCCTAATTTCAGGGAGGTTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

61

Amino Acids

7.02

Weight (kDa)

4.85

Isoelectric Point (pI)

48.3

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Mob1_phocein PF03637 1 - 55 1.3e-18 Mob1/phocein family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029482)

Species Orthologous Gene IDs
pyrus_communis pycom16g25420
rosa_roxburghii Rroxscaffold_3G00246160

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 45
AgsI TTSAA 2 cut(s) 89, 110
AluBI AGCT 1 cut(s) 148
AluI AGCT 1 cut(s) 148
AoxI GGCC 1 cut(s) 10
AspLEI GCGC 1 cut(s) 155
AspS9I GGNCC 1 cut(s) 11
BccI CCATC 3 cut(s) 24, 32, 91
BfmI CTRYAG 1 cut(s) 6
BmgT120I GGNCC 1 cut(s) 11
BmiI GGNNCC 1 cut(s) 13
Bse1I ACTGG 1 cut(s) 107
BseNI ACTGG 1 cut(s) 107
BshFI GGCC 1 cut(s) 12
BsnI GGCC 1 cut(s) 12
Bsp1407I TGTACA 1 cut(s) 43
BspANI GGCC 1 cut(s) 12
BspLI GGNNCC 1 cut(s) 13
BspMAI CTGCAG 1 cut(s) 10
BsrGI TGTACA 1 cut(s) 43
BsrI ACTGG 1 cut(s) 107
BstAUI TGTACA 1 cut(s) 43
BstC8I GCNNGC 1 cut(s) 10
BstHHI GCGC 1 cut(s) 155
BstSFI CTRYAG 1 cut(s) 6
BsuRI GGCC 1 cut(s) 12
Cac8I GCNNGC 1 cut(s) 10
CfoI GCGC 1 cut(s) 155
Cfr13I GGNCC 1 cut(s) 11
Csp6I GTAC 1 cut(s) 44
CviJI RGCY 2 cut(s) 12, 148
CviKI_1 RGCY 2 cut(s) 12, 148
CviQI GTAC 1 cut(s) 44
EcoO109I RGGNCCY 1 cut(s) 11
FaiI YATR 4 cut(s) 21, 27, 84, 134
GlaI GCGC 1 cut(s) 154
HaeIII GGCC 1 cut(s) 12
HhaI GCGC 1 cut(s) 155
Hin6I GCGC 1 cut(s) 153
HinP1I GCGC 1 cut(s) 153
HindIII AAGCTT 1 cut(s) 146
HinfI GANTC 2 cut(s) 110, 128
Hpy166II GTNNAC 1 cut(s) 44
Hpy188I TCNGA 1 cut(s) 96
Hpy8I GTNNAC 1 cut(s) 44
HpyCH4V TGCA 1 cut(s) 8
HspAI GCGC 1 cut(s) 153
LmnI GCTCC 1 cut(s) 79
LpnPI CCDG 2 cut(s) 88, 159
MluCI AATT 2 cut(s) 48, 168
MnlI CCTC 3 cut(s) 58, 150, 171
MseI TTAA 1 cut(s) 51
NlaIV GGNNCC 1 cut(s) 13
PfeI GAWTC 2 cut(s) 110, 128
PspN4I GGNNCC 1 cut(s) 13
PspPI GGNCC 1 cut(s) 11
PstI CTGCAG 1 cut(s) 10
RsaI GTAC 1 cut(s) 45
RsaNI GTAC 1 cut(s) 44
SaqAI TTAA 1 cut(s) 51
Sau96I GGNCC 1 cut(s) 11
SetI ASST 4 cut(s) 61, 69, 150, 182
SfcI CTRYAG 1 cut(s) 6
SgeI CNNG 5 cut(s) 21, 28, 115, 131, 161
Sse9I AATT 2 cut(s) 48, 168
TasI AATT 2 cut(s) 48, 168
TatI WGTACW 1 cut(s) 43
TfiI GAWTC 2 cut(s) 110, 128
Tru1I TTAA 1 cut(s) 51
Tru9I TTAA 1 cut(s) 51
TspDTI ATGAA 1 cut(s) 141
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.