Rroxscaffold_3G00259810

in the synthesis of the GDP-mannose and dolichol-phosphate-mannose required for a number of critical mannosyl transfer reactions

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Reverse (-)
54201417 .. 54205756
4340 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00259810.1

Sequence Viewer

Length: 183 bp
ATGATTAATGTATCACCAATTGGGCGAAACTGTAGCCAAGAGGAAAGAGATGAATTTGAAAGATATGACAAGGTTCACAACGTATGCCCGAAAATGGTTTCTATCCTTTGTGAGAAGTTTGCTCACTTTAACCTGACATTTTCCATAGGAGGACAGATAAGCTTTGATGTAAGTGACAGTTGA

Protein Analysis

60

Amino Acids

6.87

Weight (kDa)

5.11

Isoelectric Point (pI)

52.48

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PMM PF03332 1 - 57 2.6e-24 Eukaryotic phosphomannomutase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0030044)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0404481
rosa_roxburghii Rroxscaffold_3G00259810

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 53
AfiI CCNNNNNNNGG 1 cut(s) 94
AgsI TTSAA 1 cut(s) 59
AluBI AGCT 1 cut(s) 162
AluI AGCT 1 cut(s) 162
ApoI RAATTY 1 cut(s) 53
AseI ATTAAT 1 cut(s) 6
AsuHPI GGTGA 1 cut(s) 6
BfmI CTRYAG 1 cut(s) 31
Bsc4I CCNNNNNNNGG 1 cut(s) 94
BseLI CCNNNNNNNGG 1 cut(s) 94
BslI CCNNNNNNNGG 1 cut(s) 94
Bst4CI ACNGT 2 cut(s) 32, 179
BstSFI CTRYAG 1 cut(s) 31
CviJI RGCY 2 cut(s) 36, 162
CviKI_1 RGCY 2 cut(s) 36, 162
FaiI YATR 3 cut(s) 66, 85, 146
HindIII AAGCTT 1 cut(s) 160
HphI GGTGA 1 cut(s) 6
Hpy166II GTNNAC 1 cut(s) 76
Hpy8I GTNNAC 1 cut(s) 76
HpyCH4III ACNGT 2 cut(s) 32, 179
HpyCH4IV ACGT 1 cut(s) 81
HpySE526I ACGT 1 cut(s) 81
LpnPI CCDG 1 cut(s) 146
MaeII ACGT 1 cut(s) 81
MaeIII GTNAC 1 cut(s) 173
MfeI CAATTG 1 cut(s) 18
MluCI AATT 2 cut(s) 18, 53
MnlI CCTC 2 cut(s) 34, 143
MseI TTAA 2 cut(s) 6, 129
MunI CAATTG 1 cut(s) 18
NmuCI GTSAC 1 cut(s) 173
PshBI ATTAAT 1 cut(s) 6
SaqAI TTAA 2 cut(s) 6, 129
SetI ASST 4 cut(s) 75, 84, 135, 164
SfcI CTRYAG 1 cut(s) 31
SgeI CNNG 4 cut(s) 50, 82, 100, 145
Sse9I AATT 2 cut(s) 18, 53
TaaI ACNGT 2 cut(s) 32, 179
TaiI ACGT 1 cut(s) 84
TasI AATT 2 cut(s) 18, 53
Tru1I TTAA 2 cut(s) 6, 129
Tru9I TTAA 2 cut(s) 6, 129
TseFI GTSAC 1 cut(s) 173
Tsp45I GTSAC 1 cut(s) 173
TspDTI ATGAA 1 cut(s) 66
VspI ATTAAT 1 cut(s) 6
XapI RAATTY 1 cut(s) 53
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.