Rroxscaffold_4G00324690

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Reverse (-)
56304527 .. 56313495
8969 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00324690.1

Sequence Viewer

Length: 183 bp
ATGTCCAGGAGCAGCAAAGTGAATCACTTGCTTCCAACTTACAAGCTTCAAGCACGTCGAGAGCAAAGCTTCTATATGCAATCAATTCTAATGCAGGTTTTGAACTTTCTTGAAGATAAGCCTTCAGATGCCAAAGTGGCGATAAGCGTGGTTAGATGCCAACGTGGCGATAATCTAGATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

60

Amino Acids

6.96

Weight (kDa)

9.43

Isoelectric Point (pI)

73.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022795)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr6g0277171
rosa_roxburghii Rroxscaffold_4G00324690
rosa_rugosa Rorug05G0240200 Rorug05G0289200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 85
AcuI CTGAAG 1 cut(s) 108
AgsI TTSAA 3 cut(s) 50, 103, 113
AjiI CACGTC 1 cut(s) 56
AjnI CCWGG 1 cut(s) 5
AluBI AGCT 2 cut(s) 46, 69
AluI AGCT 2 cut(s) 46, 69
ApeKI GCWGC 1 cut(s) 12
BbvI GCAGC 1 cut(s) 24
BciT130I CCWGG 1 cut(s) 7
BfaI CTAG 1 cut(s) 176
BfuAI ACCTGC 1 cut(s) 85
BglI GCCNNNNNGGC 2 cut(s) 137, 165
BisI GCNGC 1 cut(s) 13
BlsI GCNGC 1 cut(s) 14
Bme1390I CCNGG 1 cut(s) 7
BmgBI CACGTC 1 cut(s) 56
BmrFI CCNGG 1 cut(s) 7
BmsI GCATC 2 cut(s) 118, 146
BseBI CCWGG 1 cut(s) 7
BseXI GCAGC 1 cut(s) 24
BspMI ACCTGC 1 cut(s) 85
Bst2UI CCWGG 1 cut(s) 7
BstMWI GCNNNNNNNGC 2 cut(s) 137, 165
BstNI CCWGG 1 cut(s) 7
BstSCI CCNGG 1 cut(s) 5
BstV1I GCAGC 1 cut(s) 24
BtrI CACGTC 1 cut(s) 56
BveI ACCTGC 1 cut(s) 85
CviJI RGCY 3 cut(s) 46, 69, 121
CviKI_1 RGCY 3 cut(s) 46, 69, 121
Eco57I CTGAAG 1 cut(s) 108
EcoRII CCWGG 1 cut(s) 5
FaiI YATR 2 cut(s) 75, 77
Fnu4HI GCNGC 1 cut(s) 13
Fsp4HI GCNGC 1 cut(s) 13
FspBI CTAG 1 cut(s) 176
FspEI CC 9 cut(s) 19, 48, 80, 122, 134, 135, 145, 150, 173
GluI GCNGC 1 cut(s) 13
HindIII AAGCTT 2 cut(s) 44, 67
HinfI GANTC 1 cut(s) 22
Hpy188I TCNGA 1 cut(s) 127
Hpy188III TCNNGA 3 cut(s) 59, 110, 176
Hpy99I CGWCG 1 cut(s) 60
HpyAV CCTTC 1 cut(s) 132
HpyCH4IV ACGT 2 cut(s) 55, 163
HpyCH4V TGCA 2 cut(s) 79, 94
HpyF10VI GCNNNNNNNGC 2 cut(s) 137, 165
HpySE526I ACGT 2 cut(s) 55, 163
LmnI GCTCC 1 cut(s) 9
LpnPI CCDG 2 cut(s) 19, 80
Lsp1109I GCAGC 1 cut(s) 24
LweI GCATC 2 cut(s) 118, 146
MaeI CTAG 1 cut(s) 176
MaeII ACGT 2 cut(s) 55, 163
MboII GAAGA 1 cut(s) 125
MluCI AATT 1 cut(s) 84
MmeI TCCRAC 1 cut(s) 59
MspR9I CCNGG 1 cut(s) 7
MvaI CCWGG 1 cut(s) 7
MwoI GCNNNNNNNGC 2 cut(s) 137, 165
PfeI GAWTC 1 cut(s) 22
PfoI TCCNGGA 1 cut(s) 5
PkrI GCNGC 1 cut(s) 14
Psp6I CCWGG 1 cut(s) 5
PspGI CCWGG 1 cut(s) 5
SatI GCNGC 1 cut(s) 13
ScrFI CCNGG 1 cut(s) 7
SetI ASST 5 cut(s) 48, 58, 71, 99, 166
SfaNI GCATC 2 cut(s) 118, 146
Sse9I AATT 1 cut(s) 84
SspMI CTAG 1 cut(s) 176
StyD4I CCNGG 1 cut(s) 5
TaiI ACGT 2 cut(s) 58, 166
TaqI TCGA 1 cut(s) 58
TasI AATT 1 cut(s) 84
TfiI GAWTC 1 cut(s) 22
TseI GCWGC 1 cut(s) 12
XbaI TCTAGA 1 cut(s) 175
XspI CTAG 1 cut(s) 176
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.