Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000005

Orthogroup ID

OG0030113

Physical Location & Seq

Genomic Coordinates Forward (+)

65730795 .. 65732122

Gene Structure 1328 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_5G00387000.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 177 bp

ATGGTGGGATTTGCATATCCTCTTGGTTTCATGTCCACCAGTGGCTATGTCATCCCAAACAAAGAGTTTCACTGGTTGGCTTATGCCATTTTTGGCATGCTTCTCTGCAAAATTGTTTACAAATTAACAGGTCTTATTAGACTTCAAAGCTTCAAGGAATATCATAAATTGAGCTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005739 GO:0006950 GO:0006970 GO:0008150 GO:0009628 GO:0009651 GO:0009987 GO:0019725 GO:0042592 GO:0043167 GO:0043169 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464 GO:0045454 GO:0046872 GO:0046914 GO:0050789 GO:0050794 GO:0050896 GO:0050897 GO:0065007 GO:0065008

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

TRAM_LAG1_CLN8

Protein Analysis

58

Amino Acids

6.72

Weight (kDa)

9.46

Isoelectric Point (pI)

34.1

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0030113)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr4g0386621
rosa_roxburghii	Rroxscaffold_5G00387000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AgsI	TTSAA	2 cut(s)	146, 154
AluBI	AGCT	2 cut(s)	150, 174
AluI	AGCT	2 cut(s)	150, 174
BfaI	CTAG	1 cut(s)	175
Bse1I	ACTGG	2 cut(s)	39, 77
BseGI	GGATG	1 cut(s)	51
BseNI	ACTGG	2 cut(s)	39, 77
BsrI	ACTGG	2 cut(s)	39, 77
BstC8I	GCNNGC	1 cut(s)	98
BstF5I	GGATG	1 cut(s)	51
BstNSI	RCATGY	1 cut(s)	100
BtsCI	GGATG	1 cut(s)	51
BtsIMutI	CAGTG	2 cut(s)	46, 70
Cac8I	GCNNGC	1 cut(s)	98
CviAII	CATG	2 cut(s)	31, 97
CviJI	RGCY	4 cut(s)	45, 80, 150, 174
CviKI_1	RGCY	4 cut(s)	45, 80, 150, 174
FaeI	CATG	2 cut(s)	34, 100
FaiI	YATR	6 cut(s)	16, 32, 48, 84, 98, 165
FatI	CATG	2 cut(s)	30, 96
FokI	GGATG	1 cut(s)	38
FspBI	CTAG	1 cut(s)	175
Hin1II	CATG	2 cut(s)	34, 100
HindIII	AAGCTT	1 cut(s)	148
Hpy166II	GTNNAC	2 cut(s)	36, 118
Hpy8I	GTNNAC	2 cut(s)	36, 118
HpyCH4V	TGCA	2 cut(s)	14, 108
Hsp92II	CATG	2 cut(s)	34, 100
LpnPI	CCDG	3 cut(s)	52, 58, 114
MaeI	CTAG	1 cut(s)	175
MluCI	AATT	3 cut(s)	111, 122, 167
MnlI	CCTC	1 cut(s)	30
MseI	TTAA	1 cut(s)	125
NlaIII	CATG	2 cut(s)	34, 100
NspI	RCATGY	1 cut(s)	100
PaeI	GCATGC	1 cut(s)	100
SaqAI	TTAA	1 cut(s)	125
SetI	ASST	3 cut(s)	133, 152, 176
SgeI	CNNG	7 cut(s)	35, 43, 51, 85, 109, 141, 166
SphI	GCATGC	1 cut(s)	100
Sse9I	AATT	3 cut(s)	111, 122, 167
SspMI	CTAG	1 cut(s)	175
TasI	AATT	3 cut(s)	111, 122, 167
Tru1I	TTAA	1 cut(s)	125
Tru9I	TTAA	1 cut(s)	125
TscAI	CASTG	2 cut(s)	46, 77
TspDTI	ATGAA	1 cut(s)	19
TspRI	CASTG	2 cut(s)	46, 77
XceI	RCATGY	1 cut(s)	100
XspI	CTAG	1 cut(s)	175

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.