Rroxscaffold_6G00400390

U-box domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Reverse (-)
22497026 .. 22500923
3898 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00400390.1

Sequence Viewer

Length: 231 bp
ATGAGTCACTCCTCTAGTACTCGAAGCTTTGTAACAGATAACCAGTCATGGACTTCTGACCAAGCATCCACCTCAGATGTAGTTAAAAATTATTCATCTGAGAGCCAGGTAAATATCAACCTGGAGCTAGAAAAACTGAGAATTGAACTCAGACATGTCAAAGGAATGTATGCAATGGCTCAAAGTGAGACTATTGATGCTTCTCGGAAGAAGGTGCAAAGGCTGCTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

76

Amino Acids

8.65

Weight (kDa)

8.11

Isoelectric Point (pI)

71.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0032178)

Species Orthologous Gene IDs
rosa_roxburghii Rroxscaffold_6G00400390
rosa_samantha Rh1DG361600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 19
AflIII ACRYGT 1 cut(s) 154
AgsI TTSAA 1 cut(s) 146
AjnI CCWGG 2 cut(s) 105, 120
AluBI AGCT 2 cut(s) 27, 127
AluI AGCT 2 cut(s) 27, 127
Alw26I GTCTC 1 cut(s) 182
ApeKI GCWGC 1 cut(s) 223
BbvI GCAGC 1 cut(s) 210
BciT130I CCWGG 2 cut(s) 107, 122
BcoDI GTCTC 1 cut(s) 182
BfaI CTAG 2 cut(s) 15, 128
BisI GCNGC 1 cut(s) 224
BlsI GCNGC 1 cut(s) 225
BmcAI AGTACT 1 cut(s) 19
Bme1390I CCNGG 2 cut(s) 107, 122
BmrFI CCNGG 2 cut(s) 107, 122
BmsI GCATC 2 cut(s) 74, 187
BpmI CTGGAG 1 cut(s) 143
Bse1I ACTGG 1 cut(s) 43
Bse3DI GCAATG 1 cut(s) 180
BseBI CCWGG 2 cut(s) 107, 122
BseGI GGATG 1 cut(s) 65
BseMI GCAATG 1 cut(s) 180
BseMII CTCAG 4 cut(s) 87, 90, 128, 163
BseNI ACTGG 1 cut(s) 43
BseXI GCAGC 1 cut(s) 210
BsmAI GTCTC 1 cut(s) 182
BspCNI CTCAG 4 cut(s) 86, 91, 129, 162
BsrDI GCAATG 1 cut(s) 180
BsrI ACTGG 1 cut(s) 43
Bst2UI CCWGG 2 cut(s) 107, 122
BstAPI GCANNNNNTGC 1 cut(s) 223
BstDEI CTNAG 4 cut(s) 73, 99, 137, 149
BstF5I GGATG 1 cut(s) 65
BstMAI GTCTC 1 cut(s) 182
BstMWI GCNNNNNNNGC 1 cut(s) 223
BstNI CCWGG 2 cut(s) 107, 122
BstNSI RCATGY 1 cut(s) 158
BstSCI CCNGG 2 cut(s) 105, 120
BstV1I GCAGC 1 cut(s) 210
BtsCI GGATG 1 cut(s) 65
Csp6I GTAC 1 cut(s) 18
CviAII CATG 2 cut(s) 48, 155
CviJI RGCY 5 cut(s) 27, 105, 127, 179, 223
CviKI_1 RGCY 5 cut(s) 27, 105, 127, 179, 223
CviQI GTAC 1 cut(s) 18
DdeI CTNAG 4 cut(s) 73, 99, 137, 149
EcoRII CCWGG 2 cut(s) 105, 120
FaeI CATG 2 cut(s) 51, 158
FaiI YATR 3 cut(s) 49, 156, 171
FatI CATG 2 cut(s) 47, 154
Fnu4HI GCNGC 1 cut(s) 224
FokI GGATG 1 cut(s) 52
Fsp4HI GCNGC 1 cut(s) 224
FspBI CTAG 2 cut(s) 15, 128
GluI GCNGC 1 cut(s) 224
GsuI CTGGAG 1 cut(s) 143
Hin1II CATG 2 cut(s) 51, 158
HindIII AAGCTT 1 cut(s) 25
HinfI GANTC 1 cut(s) 4
Hpy188I TCNGA 5 cut(s) 58, 76, 100, 152, 207
HpyAV CCTTC 1 cut(s) 205
HpyCH4V TGCA 2 cut(s) 173, 217
HpyF10VI GCNNNNNNNGC 1 cut(s) 223
HpyF3I CTNAG 4 cut(s) 73, 99, 137, 149
Hsp92II CATG 2 cut(s) 51, 158
LmnI GCTCC 1 cut(s) 124
LpnPI CCDG 5 cut(s) 56, 92, 107, 119, 134
Lsp1109I GCAGC 1 cut(s) 210
LweI GCATC 2 cut(s) 74, 187
MaeI CTAG 2 cut(s) 15, 128
MaeIII GTNAC 2 cut(s) 5, 31
MboII GAAGA 1 cut(s) 220
MluCI AATT 2 cut(s) 88, 141
MlyI GAGTC 1 cut(s) 13
MnlI CCTC 2 cut(s) 22, 82
MseI TTAA 1 cut(s) 84
MspR9I CCNGG 2 cut(s) 107, 122
MvaI CCWGG 2 cut(s) 107, 122
MwoI GCNNNNNNNGC 1 cut(s) 223
NlaIII CATG 2 cut(s) 51, 158
NmuCI GTSAC 1 cut(s) 5
NspI RCATGY 1 cut(s) 158
PciI ACATGT 1 cut(s) 154
PkrI GCNGC 1 cut(s) 225
PleI GAGTC 1 cut(s) 12
PpsI GAGTC 1 cut(s) 12
PscI ACATGT 1 cut(s) 154
Psp6I CCWGG 2 cut(s) 105, 120
PspGI CCWGG 2 cut(s) 105, 120
RsaI GTAC 1 cut(s) 19
RsaNI GTAC 1 cut(s) 18
SaqAI TTAA 1 cut(s) 84
SatI GCNGC 1 cut(s) 224
ScaI AGTACT 1 cut(s) 19
SchI GAGTC 1 cut(s) 13
ScrFI CCNGG 2 cut(s) 107, 122
SetI ASST 6 cut(s) 29, 74, 111, 123, 129, 216
SfaNI GCATC 2 cut(s) 74, 187
Sse9I AATT 2 cut(s) 88, 141
SspMI CTAG 2 cut(s) 15, 128
StyD4I CCNGG 2 cut(s) 105, 120
TaqI TCGA 1 cut(s) 22
TasI AATT 2 cut(s) 88, 141
TatI WGTACW 1 cut(s) 17
Tru1I TTAA 1 cut(s) 84
Tru9I TTAA 1 cut(s) 84
TseFI GTSAC 1 cut(s) 5
TseI GCWGC 1 cut(s) 223
Tsp45I GTSAC 1 cut(s) 5
TspDTI ATGAA 1 cut(s) 84
XceI RCATGY 1 cut(s) 158
XspI CTAG 2 cut(s) 15, 128
ZrmI AGTACT 1 cut(s) 19
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.