Rh1DG361600

U-box domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Reverse (-)
58892758 .. 58895439
2682 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG361600.1

Sequence Viewer

Length: 225 bp
ATGCGACTTTGCAGCTATTTGGCACAGATCGTGGATCTGTTGGTTCATACTCTCATTTTCGTTCTCCTTCCCTACCGATGCAGCGATTTCAAGCTCTTTCAAGTAAATATCAACCTGGAGCTAGAAAAACTGAGAATTGAACTCAGACATGTCAAAGGAATGTATGCAATGGCTCAAAGTGAGACTATTGATGCTTCTCGGAAGGTATACGAGTATGATGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

74

Amino Acids

8.78

Weight (kDa)

6.06

Isoelectric Point (pI)

35.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0032178)

Species Orthologous Gene IDs
rosa_roxburghii Rroxscaffold_6G00400390
rosa_samantha Rh1DG361600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 207
AclWI GGATC 1 cut(s) 42
AflIII ACRYGT 1 cut(s) 148
AgsI TTSAA 3 cut(s) 91, 101, 140
AjnI CCWGG 1 cut(s) 114
AluBI AGCT 3 cut(s) 15, 94, 121
AluI AGCT 3 cut(s) 15, 94, 121
Alw26I GTCTC 1 cut(s) 176
AlwI GGATC 1 cut(s) 42
ApeKI GCWGC 2 cut(s) 12, 81
BbvI GCAGC 2 cut(s) 24, 93
BciT130I CCWGG 1 cut(s) 116
BcoDI GTCTC 1 cut(s) 176
BfaI CTAG 1 cut(s) 122
BisI GCNGC 2 cut(s) 13, 82
BlsI GCNGC 2 cut(s) 14, 83
Bme1390I CCNGG 1 cut(s) 116
BmrFI CCNGG 1 cut(s) 116
BmsI GCATC 2 cut(s) 68, 181
BpmI CTGGAG 1 cut(s) 137
Bse3DI GCAATG 1 cut(s) 174
BseBI CCWGG 1 cut(s) 116
BseMI GCAATG 1 cut(s) 174
BseMII CTCAG 2 cut(s) 122, 157
BseXI GCAGC 2 cut(s) 24, 93
BsmAI GTCTC 1 cut(s) 176
Bsp143I GATC 2 cut(s) 27, 34
BspCNI CTCAG 2 cut(s) 123, 156
BspPI GGATC 1 cut(s) 42
BsrDI GCAATG 1 cut(s) 174
BssMI GATC 2 cut(s) 27, 34
BssNAI GTATAC 1 cut(s) 208
Bst1107I GTATAC 1 cut(s) 208
Bst2UI CCWGG 1 cut(s) 116
BstDEI CTNAG 2 cut(s) 131, 143
BstKTI GATC 2 cut(s) 30, 37
BstMAI GTCTC 1 cut(s) 176
BstMBI GATC 2 cut(s) 27, 34
BstNI CCWGG 1 cut(s) 116
BstNSI RCATGY 1 cut(s) 152
BstSCI CCNGG 1 cut(s) 114
BstV1I GCAGC 2 cut(s) 24, 93
BstX2I RGATCY 1 cut(s) 34
BstYI RGATCY 1 cut(s) 34
BstZ17I GTATAC 1 cut(s) 208
CviAII CATG 1 cut(s) 149
CviJI RGCY 4 cut(s) 15, 94, 121, 173
CviKI_1 RGCY 4 cut(s) 15, 94, 121, 173
DdeI CTNAG 2 cut(s) 131, 143
DpnI GATC 2 cut(s) 29, 36
DpnII GATC 2 cut(s) 27, 34
EcoRII CCWGG 1 cut(s) 114
FaeI CATG 1 cut(s) 152
FaiI YATR 5 cut(s) 48, 150, 165, 208, 216
FatI CATG 1 cut(s) 148
FblI GTMKAC 1 cut(s) 207
Fnu4HI GCNGC 2 cut(s) 13, 82
Fsp4HI GCNGC 2 cut(s) 13, 82
FspBI CTAG 1 cut(s) 122
GluI GCNGC 2 cut(s) 13, 82
GsuI CTGGAG 1 cut(s) 137
Hin1II CATG 1 cut(s) 152
Hpy166II GTNNAC 1 cut(s) 208
Hpy188I TCNGA 2 cut(s) 146, 201
Hpy8I GTNNAC 1 cut(s) 208
HpyAV CCTTC 2 cut(s) 77, 196
HpyCH4V TGCA 3 cut(s) 12, 81, 167
HpyF3I CTNAG 2 cut(s) 131, 143
Hsp92II CATG 1 cut(s) 152
Kzo9I GATC 2 cut(s) 27, 34
LmnI GCTCC 1 cut(s) 118
LpnPI CCDG 2 cut(s) 101, 128
Lsp1109I GCAGC 2 cut(s) 24, 93
LweI GCATC 2 cut(s) 68, 181
MaeI CTAG 1 cut(s) 122
MalI GATC 2 cut(s) 29, 36
MboI GATC 2 cut(s) 27, 34
MflI RGATCY 1 cut(s) 34
MluCI AATT 1 cut(s) 135
MspR9I CCNGG 1 cut(s) 116
MvaI CCWGG 1 cut(s) 116
NdeII GATC 2 cut(s) 27, 34
NlaIII CATG 1 cut(s) 152
NspI RCATGY 1 cut(s) 152
PciI ACATGT 1 cut(s) 148
PkrI GCNGC 2 cut(s) 14, 83
PscI ACATGT 1 cut(s) 148
Psp6I CCWGG 1 cut(s) 114
PspGI CCWGG 1 cut(s) 114
PsuI RGATCY 1 cut(s) 34
SatI GCNGC 2 cut(s) 13, 82
Sau3AI GATC 2 cut(s) 27, 34
ScrFI CCNGG 1 cut(s) 116
SetI ASST 5 cut(s) 17, 96, 117, 123, 207
SfaNI GCATC 2 cut(s) 68, 181
SgeI CNNG 8 cut(s) 43, 103, 113, 127, 128, 134, 161, 210
Sse9I AATT 1 cut(s) 135
SspMI CTAG 1 cut(s) 122
StyD4I CCNGG 1 cut(s) 114
TasI AATT 1 cut(s) 135
TseI GCWGC 2 cut(s) 12, 81
TspDTI ATGAA 1 cut(s) 35
XceI RCATGY 1 cut(s) 152
XmiI GTMKAC 1 cut(s) 207
XspI CTAG 1 cut(s) 122
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.