Rroxscaffold_6G00405060

serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Reverse (-)
27534282 .. 27535622
1341 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00405060.1

Sequence Viewer

Length: 255 bp
ATGTTCAGACCAAAAGAAGAGGTGATTGTTATGATAGACCTAGTATTGAATCATATTCAGGGTCAGTTACCAAAGGCGCAGAAGATTGCTGTAAAAAGGTTGTCTAAAACTTCTGGACAAGGAATTGAAGAATTCAAAAATGAAGTCGGGCTGATAGCCAGACTTCAACACAGGAATCTTGTGAAACTTATAGGCTGTTGTATACATGGAGAAGAAAGGATATTAGTAGTCGAATACATGCCCAACAAAAGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

84

Amino Acids

9.58

Weight (kDa)

9.34

Isoelectric Point (pI)

53.18

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PK_Tyr_Ser-Thr PF07714 25 - 82 6e-11 Protein tyrosine and serine/threonine kinase
Pkinase PF00069 25 - 83 1.8e-07 Protein kinase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029915)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr3g0476701
rosa_roxburghii Rroxscaffold_6G00405060

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 202
AcsI RAATTY 1 cut(s) 131
AgsI TTSAA 4 cut(s) 49, 128, 136, 167
AluBI AGCT 1 cut(s) 252
AluI AGCT 1 cut(s) 252
ApoI RAATTY 1 cut(s) 131
ArsI GACNNNNNNTTYG 2 cut(s) 129, 161
AspLEI GCGC 1 cut(s) 79
AsuHPI GGTGA 1 cut(s) 34
BfaI CTAG 2 cut(s) 41, 253
BssNAI GTATAC 1 cut(s) 203
Bst1107I GTATAC 1 cut(s) 203
Bst6I CTCTTC 1 cut(s) 12
BstHHI GCGC 1 cut(s) 79
BstNSI RCATGY 1 cut(s) 241
BstZ17I GTATAC 1 cut(s) 203
CfoI GCGC 1 cut(s) 79
CviAII CATG 2 cut(s) 206, 238
CviJI RGCY 4 cut(s) 151, 158, 195, 252
CviKI_1 RGCY 4 cut(s) 151, 158, 195, 252
Eam1104I CTCTTC 1 cut(s) 12
EarI CTCTTC 1 cut(s) 12
EcoRI GAATTC 1 cut(s) 131
FaeI CATG 2 cut(s) 209, 241
FaiI YATR 6 cut(s) 32, 54, 191, 203, 207, 239
FatI CATG 2 cut(s) 205, 237
FblI GTMKAC 1 cut(s) 202
FspBI CTAG 2 cut(s) 41, 253
GlaI GCGC 1 cut(s) 78
HhaI GCGC 1 cut(s) 79
Hin1II CATG 2 cut(s) 209, 241
Hin6I GCGC 1 cut(s) 77
HinP1I GCGC 1 cut(s) 77
HinfI GANTC 2 cut(s) 49, 175
HphI GGTGA 1 cut(s) 34
Hpy166II GTNNAC 1 cut(s) 203
Hpy188I TCNGA 1 cut(s) 8
Hpy188III TCNNGA 1 cut(s) 114
Hpy8I GTNNAC 1 cut(s) 203
Hsp92II CATG 2 cut(s) 209, 241
HspAI GCGC 1 cut(s) 77
LpnPI CCDG 4 cut(s) 44, 99, 157, 172
MaeI CTAG 2 cut(s) 41, 253
MaeIII GTNAC 1 cut(s) 66
MboII GAAGA 4 cut(s) 29, 94, 140, 224
MluCI AATT 2 cut(s) 123, 131
MnlI CCTC 1 cut(s) 13
NlaIII CATG 2 cut(s) 209, 241
NspI RCATGY 1 cut(s) 241
PfeI GAWTC 2 cut(s) 49, 175
SetI ASST 4 cut(s) 24, 42, 101, 254
Sse9I AATT 2 cut(s) 123, 131
SspMI CTAG 2 cut(s) 41, 253
TaqI TCGA 1 cut(s) 231
TasI AATT 2 cut(s) 123, 131
TfiI GAWTC 2 cut(s) 49, 175
TspDTI ATGAA 1 cut(s) 156
XapI RAATTY 1 cut(s) 131
XceI RCATGY 1 cut(s) 241
XmiI GTMKAC 1 cut(s) 202
XspI CTAG 2 cut(s) 41, 253
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.