Rroxscaffold_6G00423440

microtubule binding

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Forward (+)
44597803 .. 44598670
868 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00423440.1

Sequence Viewer

Length: 192 bp
ATGCAAATAGTTATTACTGTTGGAGATGAGCAACCTGCCATGGACAAAAAGCAGTTTGTGGGGTTCATAAAGAGTTTTGTTGGGGAGAGCATGCATGATGATGAGAGCATAGTGTTTGCATACTACAAGGAAGGTGCTACTGAGCCGACCTTCATCTATCTTGCCCATGGCTTGAAGGAAGTCAAGTGTTGA

Protein Analysis

63

Amino Acids

7.12

Weight (kDa)

4.89

Isoelectric Point (pI)

28.83

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TCTP PF00838 24 - 59 1.3e-07 Translationally controlled tumour protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021224)

Species Orthologous Gene IDs
prunus_persica Prupe.6G320200_v2.0.a1
rosa_chinensis RchiOBHm_Chr3g0455811
rosa_roxburghii Rroxscaffold_6G00423440
rosa_wichuraiana Rw3G005660 Rw3G006010

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 43
AgsI TTSAA 1 cut(s) 175
BfuAI ACCTGC 1 cut(s) 43
BsaJI CCNNGG 2 cut(s) 39, 166
BseDI CCNNGG 2 cut(s) 39, 166
BseMII CTCAG 1 cut(s) 132
Bsp19I CCATGG 2 cut(s) 39, 166
BspCNI CTCAG 1 cut(s) 133
BspMI ACCTGC 1 cut(s) 43
BssECI CCNNGG 2 cut(s) 39, 166
BssT1I CCWWGG 2 cut(s) 39, 166
Bst4CI ACNGT 1 cut(s) 19
BstC8I GCNNGC 1 cut(s) 92
BstDEI CTNAG 1 cut(s) 141
BstDSI CCRYGG 2 cut(s) 39, 166
BstNSI RCATGY 1 cut(s) 94
BtgI CCRYGG 2 cut(s) 39, 166
BveI ACCTGC 1 cut(s) 43
Cac8I GCNNGC 1 cut(s) 92
CviAII CATG 4 cut(s) 40, 91, 95, 167
CviJI RGCY 2 cut(s) 145, 171
CviKI_1 RGCY 2 cut(s) 145, 171
DdeI CTNAG 1 cut(s) 141
Eco130I CCWWGG 2 cut(s) 39, 166
EcoT14I CCWWGG 2 cut(s) 39, 166
EcoT22I ATGCAT 1 cut(s) 96
ErhI CCWWGG 2 cut(s) 39, 166
FaeI CATG 4 cut(s) 43, 94, 98, 170
FaiI YATR 7 cut(s) 41, 68, 92, 96, 110, 121, 168
FatI CATG 4 cut(s) 39, 90, 94, 166
Hin1II CATG 4 cut(s) 43, 94, 98, 170
HpyAV CCTTC 3 cut(s) 125, 160, 169
HpyCH4III ACNGT 1 cut(s) 19
HpyCH4V TGCA 3 cut(s) 4, 94, 119
HpyF3I CTNAG 1 cut(s) 141
Hsp92II CATG 4 cut(s) 43, 94, 98, 170
LpnPI CCDG 1 cut(s) 48
Mph1103I ATGCAT 1 cut(s) 96
MslI CAYNNNNRTG 1 cut(s) 99
NcoI CCATGG 2 cut(s) 39, 166
NlaIII CATG 4 cut(s) 43, 94, 98, 170
NsiI ATGCAT 1 cut(s) 96
NspI RCATGY 1 cut(s) 94
PaeI GCATGC 1 cut(s) 94
RseI CAYNNNNRTG 1 cut(s) 99
SetI ASST 3 cut(s) 37, 136, 152
SgeI CNNG 8 cut(s) 47, 52, 103, 107, 139, 173, 179, 184
SmiMI CAYNNNNRTG 1 cut(s) 99
SphI GCATGC 1 cut(s) 94
StyI CCWWGG 2 cut(s) 39, 166
TaaI ACNGT 1 cut(s) 19
TspDTI ATGAA 2 cut(s) 55, 142
XceI RCATGY 1 cut(s) 94
Zsp2I ATGCAT 1 cut(s) 96
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.