Rroxscaffold_7G00205680

plastid-lipid-associated protein 14, chloroplastic

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Reverse (-)
55309659 .. 55311065
1407 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00205680.1

Sequence Viewer

Length: 303 bp
ATGCATGATCCGAAGAAAGGTGGAGACAATTATAGGGAGGGCTCGACTCTCCCTCTCACTGACAAAAATGGGAAACCCTCCATTCTCACCGATCCTTCGCTCTCCTTCTTCCGGGATTACCTCAAAAGGAGCACTTACAAGCGCTCAAGTAACATGGATAGACTAAAGATGATTGCTTATGATACTAGATGTCTTGGATTCATGATGGCAAAAATGGTGTTCCAGGAACTCATGGACCCCTCAAAATTCCCAAAGTTCAAGTCATTTCTCACGAAGGTATCAGAAGCCAAATGTTCTATTTAG

Protein Analysis

100

Amino Acids

11.55

Weight (kDa)

9.66

Isoelectric Point (pI)

48.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0032188)

Species Orthologous Gene IDs
rosa_roxburghii Rroxscaffold_6G00417020 Rroxscaffold_7G00205680

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 2, 86
AcsI RAATTY 1 cut(s) 245
AfeI AGCGCT 1 cut(s) 143
AfiI CCNNNNNNNGG 2 cut(s) 17, 111
AgsI TTSAA 1 cut(s) 259
AjnI CCWGG 1 cut(s) 222
Alw21I GWGCWC 1 cut(s) 134
Alw26I GTCTC 1 cut(s) 18
AlwI GGATC 2 cut(s) 2, 86
Aor51HI AGCGCT 1 cut(s) 143
ApoI RAATTY 1 cut(s) 245
ArsI GACNNNNNNTTYG 2 cut(s) 245, 277
AspLEI GCGC 1 cut(s) 144
AspS9I GGNCC 1 cut(s) 235
AsuC2I CCSGG 1 cut(s) 113
AsuHPI GGTGA 1 cut(s) 79
AvaII GGWCC 1 cut(s) 235
BaeI ACNNNNGTAYC 2 cut(s) 261, 294
BanII GRGCYC 1 cut(s) 44
Bbv12I GWGCWC 1 cut(s) 134
BccI CCATC 1 cut(s) 199
BciT130I CCWGG 1 cut(s) 224
BcnI CCSGG 1 cut(s) 113
BcoDI GTCTC 1 cut(s) 18
BfaI CTAG 1 cut(s) 186
BfoI RGCGCY 1 cut(s) 145
Bme1390I CCNGG 2 cut(s) 113, 224
Bme18I GGWCC 1 cut(s) 235
BmgT120I GGNCC 1 cut(s) 235
BmiI GGNNCC 1 cut(s) 237
BmrFI CCNGG 2 cut(s) 113, 224
BpuEI CTTGAG 1 cut(s) 130
BpuMI CCSGG 1 cut(s) 113
Bsc4I CCNNNNNNNGG 2 cut(s) 17, 111
BseBI CCWGG 1 cut(s) 224
BseLI CCNNNNNNNGG 2 cut(s) 17, 111
BsiHKAI GWGCWC 1 cut(s) 134
BsiSI CCGG 1 cut(s) 112
BslI CCNNNNNNNGG 2 cut(s) 17, 111
BsmAI GTCTC 1 cut(s) 18
Bsp1286I GDGCHC 2 cut(s) 44, 134
Bsp143I GATC 2 cut(s) 7, 91
BspHI TCATGA 1 cut(s) 201
BspLI GGNNCC 1 cut(s) 237
BspPI GGATC 2 cut(s) 2, 86
BssMI GATC 2 cut(s) 7, 91
Bst2UI CCWGG 1 cut(s) 224
BstH2I RGCGCY 1 cut(s) 145
BstHHI GCGC 1 cut(s) 144
BstKTI GATC 2 cut(s) 10, 94
BstMAI GTCTC 1 cut(s) 18
BstMBI GATC 2 cut(s) 7, 91
BstNI CCWGG 1 cut(s) 224
BstSCI CCNGG 2 cut(s) 111, 222
BtsIMutI CAGTG 1 cut(s) 57
CciI TCATGA 1 cut(s) 201
CfoI GCGC 1 cut(s) 144
Cfr13I GGNCC 1 cut(s) 235
CviAII CATG 4 cut(s) 5, 154, 202, 232
CviJI RGCY 2 cut(s) 42, 287
CviKI_1 RGCY 2 cut(s) 42, 287
DpnI GATC 2 cut(s) 9, 93
DpnII GATC 2 cut(s) 7, 91
Eco24I GRGCYC 1 cut(s) 44
Eco47I GGWCC 1 cut(s) 235
Eco47III AGCGCT 1 cut(s) 143
EcoRII CCWGG 1 cut(s) 222
EcoT22I ATGCAT 1 cut(s) 6
EcoT38I GRGCYC 1 cut(s) 44
FaeI CATG 4 cut(s) 8, 157, 205, 235
FaiI YATR 6 cut(s) 6, 33, 155, 180, 203, 233
FalI AAGNNNNNCTT 2 cut(s) 118, 150
FatI CATG 4 cut(s) 4, 153, 201, 231
FriOI GRGCYC 1 cut(s) 44
FspBI CTAG 1 cut(s) 186
GlaI GCGC 1 cut(s) 143
HaeII RGCGCY 1 cut(s) 145
HapII CCGG 1 cut(s) 112
HhaI GCGC 1 cut(s) 144
Hin1II CATG 4 cut(s) 8, 157, 205, 235
Hin6I GCGC 1 cut(s) 142
HinP1I GCGC 1 cut(s) 142
HinfI GANTC 2 cut(s) 46, 198
HpaII CCGG 1 cut(s) 112
HphI GGTGA 1 cut(s) 79
Hpy188I TCNGA 2 cut(s) 12, 283
Hpy188III TCNNGA 2 cut(s) 202, 271
HpyAV CCTTC 3 cut(s) 105, 115, 268
HpyCH4V TGCA 1 cut(s) 4
Hsp92II CATG 4 cut(s) 8, 157, 205, 235
HspAI GCGC 1 cut(s) 142
Kzo9I GATC 2 cut(s) 7, 91
LmnI GCTCC 1 cut(s) 129
LpnPI CCDG 3 cut(s) 125, 209, 236
MaeI CTAG 1 cut(s) 186
MaeIII GTNAC 1 cut(s) 149
MalI GATC 2 cut(s) 9, 93
MboI GATC 2 cut(s) 7, 91
MboII GAAGA 2 cut(s) 25, 100
MhlI GDGCHC 2 cut(s) 44, 134
MluCI AATT 2 cut(s) 28, 245
MlyI GAGTC 1 cut(s) 40
MnlI CCTC 5 cut(s) 31, 63, 88, 131, 250
Mph1103I ATGCAT 1 cut(s) 6
MspI CCGG 1 cut(s) 112
MspR9I CCNGG 2 cut(s) 113, 224
MvaI CCWGG 1 cut(s) 224
NciI CCSGG 1 cut(s) 113
NdeII GATC 2 cut(s) 7, 91
NlaIII CATG 4 cut(s) 8, 157, 205, 235
NlaIV GGNNCC 1 cut(s) 237
NsiI ATGCAT 1 cut(s) 6
PagI TCATGA 1 cut(s) 201
PfeI GAWTC 1 cut(s) 198
PfoI TCCNGGA 2 cut(s) 111, 222
PleI GAGTC 1 cut(s) 40
PpsI GAGTC 1 cut(s) 40
Psp6I CCWGG 1 cut(s) 222
PspGI CCWGG 1 cut(s) 222
PspN4I GGNNCC 1 cut(s) 237
PspPI GGNCC 1 cut(s) 235
Sau3AI GATC 2 cut(s) 7, 91
Sau96I GGNCC 1 cut(s) 235
SchI GAGTC 1 cut(s) 40
ScrFI CCNGG 2 cut(s) 113, 224
SduI GDGCHC 2 cut(s) 44, 134
SetI ASST 3 cut(s) 22, 123, 279
SinI GGWCC 1 cut(s) 235
SmlI CTYRAG 1 cut(s) 145
SmoI CTYRAG 1 cut(s) 145
Sse9I AATT 2 cut(s) 28, 245
SspMI CTAG 1 cut(s) 186
StyD4I CCNGG 2 cut(s) 111, 222
TaqI TCGA 1 cut(s) 44
TasI AATT 2 cut(s) 28, 245
TfiI GAWTC 1 cut(s) 198
TscAI CASTG 1 cut(s) 64
TspDTI ATGAA 1 cut(s) 190
TspRI CASTG 1 cut(s) 64
VpaK11BI GGWCC 1 cut(s) 235
XapI RAATTY 1 cut(s) 245
XspI CTAG 1 cut(s) 186
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.