Rh1AG092500

receptor-like protein kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Forward (+)
16059787 .. 16071584
11798 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG092500.1

Sequence Viewer

Length: 228 bp
ATGAAGGGGGTGGTTCAGATGTTGGAAGGAGGAGAAAACTTAACTATGCCTCCAAATCCTTTTTCCTCTCAAGGTCCTACAGGAACAAGTGCAAGTACACCTGCCAGAAGATTAAACCTTCAACTGGAAGCAATTGCCGACCTACCAACTTCTCGAAATCTTGGGAAGCCAATCTCTCTCCAACAAGACAGCATCAAGGCAAAAGATCTAGACTACCATACACGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

75

Amino Acids

8.09

Weight (kDa)

8.16

Isoelectric Point (pI)

52.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0032875)

Species Orthologous Gene IDs
rosa_samantha Rh1AG092500 Rh1CG089300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 109
Acc36I ACCTGC 1 cut(s) 109
AfaI GTAC 1 cut(s) 97
AfiI CCNNNNNNNGG 1 cut(s) 124
AflIII ACRYGT 1 cut(s) 221
AgsI TTSAA 1 cut(s) 122
AjuI GAANNNNNNNTTGG 2 cut(s) 46, 78
AspS9I GGNCC 1 cut(s) 74
AvaII GGWCC 1 cut(s) 74
BfaI CTAG 1 cut(s) 209
BfmI CTRYAG 1 cut(s) 78
BfuAI ACCTGC 1 cut(s) 109
BglII AGATCT 1 cut(s) 205
Bme18I GGWCC 1 cut(s) 74
BmgT120I GGNCC 1 cut(s) 74
BmsI GCATC 1 cut(s) 201
BpuEI CTTGAG 1 cut(s) 54
BsaXI ACNNNNNCTCC 2 cut(s) 34, 64
Bsc4I CCNNNNNNNGG 1 cut(s) 124
Bse1I ACTGG 1 cut(s) 129
BseLI CCNNNNNNNGG 1 cut(s) 124
BseNI ACTGG 1 cut(s) 129
BseRI GAGGAG 1 cut(s) 45
BslI CCNNNNNNNGG 1 cut(s) 124
Bsp143I GATC 1 cut(s) 205
BspMI ACCTGC 1 cut(s) 109
BsrI ACTGG 1 cut(s) 129
BssMI GATC 1 cut(s) 205
BstKTI GATC 1 cut(s) 208
BstMBI GATC 1 cut(s) 205
BstSFI CTRYAG 1 cut(s) 78
BstX2I RGATCY 1 cut(s) 205
BstYI RGATCY 1 cut(s) 205
BveI ACCTGC 1 cut(s) 109
Cfr13I GGNCC 1 cut(s) 74
Csp6I GTAC 1 cut(s) 96
CviJI RGCY 1 cut(s) 169
CviKI_1 RGCY 1 cut(s) 169
CviQI GTAC 1 cut(s) 96
DpnI GATC 1 cut(s) 207
DpnII GATC 1 cut(s) 205
Eco47I GGWCC 1 cut(s) 74
EcoO109I RGGNCCY 1 cut(s) 74
FaiI YATR 2 cut(s) 47, 219
FspBI CTAG 1 cut(s) 209
Hpy166II GTNNAC 1 cut(s) 98
Hpy188I TCNGA 1 cut(s) 18
Hpy188III TCNNGA 2 cut(s) 153, 209
Hpy8I GTNNAC 1 cut(s) 98
HpyAV CCTTC 2 cut(s) 20, 128
HpyCH4IV ACGT 1 cut(s) 223
HpyCH4V TGCA 1 cut(s) 92
HpySE526I ACGT 1 cut(s) 223
Kzo9I GATC 1 cut(s) 205
LpnPI CCDG 4 cut(s) 66, 110, 114, 118
LweI GCATC 1 cut(s) 201
MaeI CTAG 1 cut(s) 209
MaeII ACGT 1 cut(s) 223
MalI GATC 1 cut(s) 207
MboI GATC 1 cut(s) 205
MboII GAAGA 1 cut(s) 120
MfeI CAATTG 1 cut(s) 132
MflI RGATCY 1 cut(s) 205
MluCI AATT 1 cut(s) 132
MmeI TCCRAC 1 cut(s) 205
MnlI CCTC 3 cut(s) 23, 60, 76
MseI TTAA 2 cut(s) 41, 113
MunI CAATTG 1 cut(s) 132
NdeII GATC 1 cut(s) 205
PaqCI CACCTGC 1 cut(s) 109
PpuMI RGGWCCY 1 cut(s) 74
Psp5II RGGWCCY 1 cut(s) 74
PspPI GGNCC 1 cut(s) 74
PspPPI RGGWCCY 1 cut(s) 74
PsuI RGATCY 1 cut(s) 205
RsaI GTAC 1 cut(s) 97
RsaNI GTAC 1 cut(s) 96
SaqAI TTAA 2 cut(s) 41, 113
Sau3AI GATC 1 cut(s) 205
Sau96I GGNCC 1 cut(s) 74
SetI ASST 5 cut(s) 76, 103, 120, 144, 226
SfaNI GCATC 1 cut(s) 201
SfcI CTRYAG 1 cut(s) 78
SinI GGWCC 1 cut(s) 74
SmlI CTYRAG 1 cut(s) 69
SmoI CTYRAG 1 cut(s) 69
Sse9I AATT 1 cut(s) 132
SspMI CTAG 1 cut(s) 209
TaiI ACGT 1 cut(s) 226
TaqI TCGA 1 cut(s) 154
TasI AATT 1 cut(s) 132
TatI WGTACW 1 cut(s) 95
Tru1I TTAA 2 cut(s) 41, 113
Tru9I TTAA 2 cut(s) 41, 113
TspDTI ATGAA 1 cut(s) 17
VpaK11BI GGWCC 1 cut(s) 74
XbaI TCTAGA 1 cut(s) 208
XspI CTAG 1 cut(s) 209
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.