Rh1CG089300

receptor-like protein kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
Physical Location & Seq
Forward (+)
18882278 .. 18888899
6622 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG089300.1

Sequence Viewer

Length: 264 bp
ATGAAGGGGGTGGTTCAGATGTTGGAAGGAGGAGAAAACTTAACTATGCCTCCAAATCCTTTTTCCTCTCAAGGTCCTACAGGAACAAGTGCAAGTACACCTGCCAGAAGATTAAACCTTCAACTGGAAGCAATTGCCGACCTACCAAGTTCTCGAAATCTTGGGAAGCCAATCTCTCTCAAACAAGACAGCATCAAGGTAAAAAGAGATAGAAACTTTACTCCAACATCAATTGCAAAAGATCTAGACTACCATACACGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

87

Amino Acids

9.49

Weight (kDa)

9.86

Isoelectric Point (pI)

48.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0032875)

Species Orthologous Gene IDs
rosa_samantha Rh1AG092500 Rh1CG089300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 109
Acc36I ACCTGC 1 cut(s) 109
AfaI GTAC 1 cut(s) 97
AfiI CCNNNNNNNGG 1 cut(s) 124
AflIII ACRYGT 1 cut(s) 257
AgsI TTSAA 1 cut(s) 122
AjuI GAANNNNNNNTTGG 2 cut(s) 46, 78
AspS9I GGNCC 1 cut(s) 74
AvaII GGWCC 1 cut(s) 74
BfaI CTAG 1 cut(s) 245
BfmI CTRYAG 1 cut(s) 78
BfuAI ACCTGC 1 cut(s) 109
BglII AGATCT 1 cut(s) 241
Bme18I GGWCC 1 cut(s) 74
BmgT120I GGNCC 1 cut(s) 74
BmsI GCATC 1 cut(s) 201
BpuEI CTTGAG 1 cut(s) 54
BsaXI ACNNNNNCTCC 2 cut(s) 34, 64
Bsc4I CCNNNNNNNGG 1 cut(s) 124
Bse1I ACTGG 1 cut(s) 129
BseLI CCNNNNNNNGG 1 cut(s) 124
BseNI ACTGG 1 cut(s) 129
BseRI GAGGAG 1 cut(s) 45
BslI CCNNNNNNNGG 1 cut(s) 124
Bsp143I GATC 1 cut(s) 241
BspMI ACCTGC 1 cut(s) 109
BsrI ACTGG 1 cut(s) 129
BssMI GATC 1 cut(s) 241
BstKTI GATC 1 cut(s) 244
BstMBI GATC 1 cut(s) 241
BstSFI CTRYAG 1 cut(s) 78
BstX2I RGATCY 1 cut(s) 241
BstYI RGATCY 1 cut(s) 241
BveI ACCTGC 1 cut(s) 109
Cfr13I GGNCC 1 cut(s) 74
Csp6I GTAC 1 cut(s) 96
CviJI RGCY 1 cut(s) 169
CviKI_1 RGCY 1 cut(s) 169
CviQI GTAC 1 cut(s) 96
DpnI GATC 1 cut(s) 243
DpnII GATC 1 cut(s) 241
Eco47I GGWCC 1 cut(s) 74
EcoO109I RGGNCCY 1 cut(s) 74
FaiI YATR 2 cut(s) 47, 255
FspBI CTAG 1 cut(s) 245
Hpy166II GTNNAC 1 cut(s) 98
Hpy188I TCNGA 1 cut(s) 18
Hpy188III TCNNGA 2 cut(s) 153, 245
Hpy8I GTNNAC 1 cut(s) 98
HpyAV CCTTC 2 cut(s) 20, 128
HpyCH4IV ACGT 1 cut(s) 259
HpyCH4V TGCA 2 cut(s) 92, 236
HpySE526I ACGT 1 cut(s) 259
Kzo9I GATC 1 cut(s) 241
LpnPI CCDG 4 cut(s) 66, 110, 114, 118
LweI GCATC 1 cut(s) 201
MaeI CTAG 1 cut(s) 245
MaeII ACGT 1 cut(s) 259
MalI GATC 1 cut(s) 243
MboI GATC 1 cut(s) 241
MboII GAAGA 1 cut(s) 120
MfeI CAATTG 2 cut(s) 132, 231
MflI RGATCY 1 cut(s) 241
MluCI AATT 2 cut(s) 132, 231
MmeI TCCRAC 1 cut(s) 248
MnlI CCTC 3 cut(s) 23, 60, 76
MseI TTAA 2 cut(s) 41, 113
MunI CAATTG 2 cut(s) 132, 231
NdeII GATC 1 cut(s) 241
PaqCI CACCTGC 1 cut(s) 109
PpuMI RGGWCCY 1 cut(s) 74
Psp5II RGGWCCY 1 cut(s) 74
PspPI GGNCC 1 cut(s) 74
PspPPI RGGWCCY 1 cut(s) 74
PsuI RGATCY 1 cut(s) 241
RsaI GTAC 1 cut(s) 97
RsaNI GTAC 1 cut(s) 96
SaqAI TTAA 2 cut(s) 41, 113
Sau3AI GATC 1 cut(s) 241
Sau96I GGNCC 1 cut(s) 74
SetI ASST 6 cut(s) 76, 103, 120, 144, 201, 262
SfaNI GCATC 1 cut(s) 201
SfcI CTRYAG 1 cut(s) 78
SinI GGWCC 1 cut(s) 74
SmlI CTYRAG 1 cut(s) 69
SmoI CTYRAG 1 cut(s) 69
Sse9I AATT 2 cut(s) 132, 231
SspMI CTAG 1 cut(s) 245
TaiI ACGT 1 cut(s) 262
TaqI TCGA 1 cut(s) 154
TasI AATT 2 cut(s) 132, 231
TatI WGTACW 1 cut(s) 95
Tru1I TTAA 2 cut(s) 41, 113
Tru9I TTAA 2 cut(s) 41, 113
TspDTI ATGAA 1 cut(s) 17
VpaK11BI GGWCC 1 cut(s) 74
XbaI TCTAGA 1 cut(s) 244
XspI CTAG 1 cut(s) 245
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.