Rh1BG112700

BAG family molecular chaperone regulator

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
Physical Location & Seq
Reverse (-)
19214875 .. 19215252
378 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG112700.1

Sequence Viewer

Length: 288 bp
ATGGAGAGGAACAGAGTCAATGACGACGCTGTTGGTTCGGCTGAAACAGCAAGTGAGGCAGAGCAAGAGGCTTTAATAAAAGTTGGCCATTTAACTGACAAGGCTTTTGCTAAGAGAACTGGAAGTAGTAAAATTGCTAAGGAGAAGAACAAGGAACTGTCGTCTCAGGATACAGCGATGATGATACAAGGGAATTTCAGAGCTTATCTGATCCGTAGATCACAGGCTCTCCTGGCTCTTAGAGACCTGGCAGTTGCCAAGTCCAACCTGAAGGAGCTCAGAGCATAA

Protein Analysis

95

Amino Acids

10.48

Weight (kDa)

9.63

Isoelectric Point (pI)

36.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019848)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 205
AcoI YGGCCR 1 cut(s) 85
AcsI RAATTY 1 cut(s) 193
AjnI CCWGG 2 cut(s) 231, 246
AluBI AGCT 2 cut(s) 203, 277
AluI AGCT 2 cut(s) 203, 277
Alw21I GWGCWC 1 cut(s) 279
Alw26I GTCTC 2 cut(s) 168, 237
AlwI GGATC 1 cut(s) 205
AoxI GGCC 1 cut(s) 85
ApoI RAATTY 1 cut(s) 193
ArsI GACNNNNNNTTYG 2 cut(s) 89, 121
BalI TGGCCA 1 cut(s) 87
BanII GRGCYC 1 cut(s) 279
Bbv12I GWGCWC 1 cut(s) 279
BciT130I CCWGG 2 cut(s) 233, 248
BciVI GTATCC 1 cut(s) 163
BcoDI GTCTC 2 cut(s) 168, 237
BfuI GTATCC 1 cut(s) 163
Bme1390I CCNGG 2 cut(s) 233, 248
BmrFI CCNGG 2 cut(s) 233, 248
Bpu10I CCTNAGC 1 cut(s) 138
BsaI GGTCTC 1 cut(s) 237
BsaXI ACNNNNNCTCC 2 cut(s) 213, 243
Bse1I ACTGG 1 cut(s) 124
BseBI CCWGG 2 cut(s) 233, 248
BseMII CTCAG 1 cut(s) 179
BseNI ACTGG 1 cut(s) 124
BshFI GGCC 1 cut(s) 87
BsiHKAI GWGCWC 1 cut(s) 279
BsmAI GTCTC 2 cut(s) 168, 237
BsmBI CGTCTC 1 cut(s) 168
BsnI GGCC 1 cut(s) 87
Bso31I GGTCTC 1 cut(s) 237
Bsp1286I GDGCHC 1 cut(s) 279
Bsp143I GATC 2 cut(s) 210, 218
BspANI GGCC 1 cut(s) 87
BspCNI CTCAG 1 cut(s) 178
BspPI GGATC 1 cut(s) 205
BspTNI GGTCTC 1 cut(s) 237
BsrI ACTGG 1 cut(s) 124
BssMI GATC 2 cut(s) 210, 218
Bst2UI CCWGG 2 cut(s) 233, 248
Bst4CI ACNGT 1 cut(s) 159
BstDEI CTNAG 5 cut(s) 111, 138, 165, 239, 278
BstKTI GATC 2 cut(s) 213, 221
BstMAI GTCTC 2 cut(s) 168, 237
BstMBI GATC 2 cut(s) 210, 218
BstMWI GCNNNNNNNGC 3 cut(s) 47, 56, 233
BstNI CCWGG 2 cut(s) 233, 248
BstSCI CCNGG 2 cut(s) 231, 246
BsuI GTATCC 1 cut(s) 163
BsuRI GGCC 1 cut(s) 87
BtgZI GCGATG 1 cut(s) 191
CseI GACGC 1 cut(s) 35
CviJI RGCY 8 cut(s) 41, 71, 87, 104, 203, 227, 236, 277
CviKI_1 RGCY 8 cut(s) 41, 71, 87, 104, 203, 227, 236, 277
DdeI CTNAG 5 cut(s) 111, 138, 165, 239, 278
DpnI GATC 2 cut(s) 212, 220
DpnII GATC 2 cut(s) 210, 218
EaeI YGGCCR 1 cut(s) 85
Ecl136II GAGCTC 1 cut(s) 277
Eco24I GRGCYC 1 cut(s) 279
Eco31I GGTCTC 1 cut(s) 237
Eco53kI GAGCTC 1 cut(s) 277
EcoICRI GAGCTC 1 cut(s) 277
EcoRII CCWGG 2 cut(s) 231, 246
EcoT38I GRGCYC 1 cut(s) 279
Esp3I CGTCTC 1 cut(s) 168
FaiI YATR 1 cut(s) 286
FriOI GRGCYC 1 cut(s) 279
HaeIII GGCC 1 cut(s) 87
HgaI GACGC 1 cut(s) 35
HinfI GANTC 1 cut(s) 15
Hpy188I TCNGA 3 cut(s) 200, 210, 281
Hpy188III TCNNGA 1 cut(s) 167
Hpy99I CGWCG 1 cut(s) 29
HpyAV CCTTC 1 cut(s) 265
HpyCH4III ACNGT 1 cut(s) 159
HpyF10VI GCNNNNNNNGC 3 cut(s) 47, 56, 233
HpyF3I CTNAG 5 cut(s) 111, 138, 165, 239, 278
Kzo9I GATC 2 cut(s) 210, 218
LmnI GCTCC 1 cut(s) 274
LpnPI CCDG 8 cut(s) 105, 152, 209, 218, 233, 245, 260, 281
MalI GATC 2 cut(s) 212, 220
MboI GATC 2 cut(s) 210, 218
MboII GAAGA 1 cut(s) 157
MhlI GDGCHC 1 cut(s) 279
MlsI TGGCCA 1 cut(s) 87
MluCI AATT 2 cut(s) 132, 193
MluNI TGGCCA 1 cut(s) 87
MlyI GAGTC 1 cut(s) 24
MmeI TCCRAC 1 cut(s) 288
MnlI CCTC 2 cut(s) 49, 61
Mox20I TGGCCA 1 cut(s) 87
MscI TGGCCA 1 cut(s) 87
MseI TTAA 2 cut(s) 74, 92
Msp20I TGGCCA 1 cut(s) 87
MspR9I CCNGG 2 cut(s) 233, 248
MvaI CCWGG 2 cut(s) 233, 248
MwoI GCNNNNNNNGC 3 cut(s) 47, 56, 233
NdeII GATC 2 cut(s) 210, 218
PleI GAGTC 1 cut(s) 23
PpsI GAGTC 1 cut(s) 23
Psp124BI GAGCTC 1 cut(s) 279
Psp6I CCWGG 2 cut(s) 231, 246
PspGI CCWGG 2 cut(s) 231, 246
SacI GAGCTC 1 cut(s) 279
SaqAI TTAA 2 cut(s) 74, 92
Sau3AI GATC 2 cut(s) 210, 218
SchI GAGTC 1 cut(s) 24
ScrFI CCNGG 2 cut(s) 233, 248
SduI GDGCHC 1 cut(s) 279
SetI ASST 4 cut(s) 205, 249, 270, 279
Sse9I AATT 2 cut(s) 132, 193
SstI GAGCTC 1 cut(s) 279
StyD4I CCNGG 2 cut(s) 231, 246
TaaI ACNGT 1 cut(s) 159
TasI AATT 2 cut(s) 132, 193
Tru1I TTAA 2 cut(s) 74, 92
Tru9I TTAA 2 cut(s) 74, 92
TspGWI ACGGA 1 cut(s) 203
XapI RAATTY 1 cut(s) 193
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.