Rh1CG096900

Cysteine desulfurase 2

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
OG0024792
Physical Location & Seq
Reverse (-)
20731553 .. 20732034
482 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG096900.1

Sequence Viewer

Length: 207 bp
ATGCAATATGAATTGGCGAGAAAGAAGATTTCAGAATTTATCAATGCATCAGATGCTCGAGAAATTGTTTTTACTAGGAATGCTACTGAAGCTATCAATCTGGTTGCTCACTCGTGGGGACTCCAAAATATAAAATCAAATGATGAGATCTTACTCACAGTTGCCGAACATCACAATGCAGTGCGATTGTTCCCTGGCAACTTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00450 ko01100 map00450 map01100
Pfam Domains
Protein Families
Aminotran_5

Protein Analysis

68

Amino Acids

7.72

Weight (kDa)

6.25

Isoelectric Point (pI)

31.2

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Aminotran_5 PF00266 2 - 60 4.6e-18 Aminotransferase class-V
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0024792)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0329791
rosa_samantha Rh1AG092300 Rh1CG096900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 35
AcuI CTGAAG 1 cut(s) 108
AjnI CCWGG 1 cut(s) 193
AluBI AGCT 1 cut(s) 92
AluI AGCT 1 cut(s) 92
Ama87I CYCGRG 1 cut(s) 57
ApoI RAATTY 1 cut(s) 35
AvaI CYCGRG 1 cut(s) 57
BauI CACGAG 1 cut(s) 112
BciT130I CCWGG 1 cut(s) 195
BfaI CTAG 1 cut(s) 75
BglII AGATCT 1 cut(s) 147
Bme1390I CCNGG 1 cut(s) 195
BmeT110I CYCGRG 1 cut(s) 57
BmrFI CCNGG 1 cut(s) 195
BmsI GCATC 2 cut(s) 43, 56
BsaJI CCNNGG 1 cut(s) 193
BseBI CCWGG 1 cut(s) 195
BseDI CCNNGG 1 cut(s) 193
BsiHKCI CYCGRG 1 cut(s) 57
BslFI GGGAC 1 cut(s) 132
BsmFI GGGAC 1 cut(s) 132
BsmI GAATGC 1 cut(s) 85
BsoBI CYCGRG 1 cut(s) 57
Bsp143I GATC 1 cut(s) 147
BssECI CCNNGG 1 cut(s) 193
BssMI GATC 1 cut(s) 147
BssSI CACGAG 1 cut(s) 112
Bst2BI CACGAG 1 cut(s) 112
Bst2UI CCWGG 1 cut(s) 195
Bst4CI ACNGT 1 cut(s) 160
BstAPI GCANNNNNTGC 1 cut(s) 53
BstKTI GATC 1 cut(s) 150
BstMBI GATC 1 cut(s) 147
BstMWI GCNNNNNNNGC 2 cut(s) 53, 89
BstNI CCWGG 1 cut(s) 195
BstSCI CCNGG 1 cut(s) 193
BstX2I RGATCY 1 cut(s) 147
BstYI RGATCY 1 cut(s) 147
BtsI GCAGTG 1 cut(s) 186
BtsIMutI CAGTG 1 cut(s) 186
CviJI RGCY 1 cut(s) 92
CviKI_1 RGCY 1 cut(s) 92
DpnI GATC 1 cut(s) 149
DpnII GATC 1 cut(s) 147
Eco57I CTGAAG 1 cut(s) 108
Eco88I CYCGRG 1 cut(s) 57
EcoRII CCWGG 1 cut(s) 193
EcoT22I ATGCAT 1 cut(s) 49
FaiI YATR 2 cut(s) 9, 131
FaqI GGGAC 1 cut(s) 132
FspBI CTAG 1 cut(s) 75
FspEI CC 8 cut(s) 61, 86, 100, 101, 102, 137, 178, 180
HinfI GANTC 1 cut(s) 120
Hpy188I TCNGA 2 cut(s) 34, 52
Hpy188III TCNNGA 1 cut(s) 59
HpyCH4III ACNGT 1 cut(s) 160
HpyCH4V TGCA 3 cut(s) 4, 47, 179
HpyF10VI GCNNNNNNNGC 2 cut(s) 53, 89
Kzo9I GATC 1 cut(s) 147
LpnPI CCDG 2 cut(s) 86, 180
LweI GCATC 2 cut(s) 43, 56
MaeI CTAG 1 cut(s) 75
MalI GATC 1 cut(s) 149
MboI GATC 1 cut(s) 147
MboII GAAGA 1 cut(s) 37
MflI RGATCY 1 cut(s) 147
MluCI AATT 3 cut(s) 11, 35, 63
MlyI GAGTC 1 cut(s) 114
Mph1103I ATGCAT 1 cut(s) 49
MslI CAYNNNNRTG 1 cut(s) 174
MspR9I CCNGG 1 cut(s) 195
Mva1269I GAATGC 1 cut(s) 85
MvaI CCWGG 1 cut(s) 195
MwoI GCNNNNNNNGC 2 cut(s) 53, 89
NdeII GATC 1 cut(s) 147
NsiI ATGCAT 1 cut(s) 49
PaeR7I CTCGAG 1 cut(s) 57
PctI GAATGC 1 cut(s) 85
PleI GAGTC 1 cut(s) 114
PpsI GAGTC 1 cut(s) 114
Psp6I CCWGG 1 cut(s) 193
PspGI CCWGG 1 cut(s) 193
PsuI RGATCY 1 cut(s) 147
RseI CAYNNNNRTG 1 cut(s) 174
Sau3AI GATC 1 cut(s) 147
SchI GAGTC 1 cut(s) 114
ScrFI CCNGG 1 cut(s) 195
SetI ASST 1 cut(s) 94
SfaNI GCATC 2 cut(s) 43, 56
Sfr274I CTCGAG 1 cut(s) 57
SgeI CNNG 7 cut(s) 30, 69, 71, 87, 113, 124, 126
SlaI CTCGAG 1 cut(s) 57
SmiMI CAYNNNNRTG 1 cut(s) 174
SmlI CTYRAG 1 cut(s) 57
SmoI CTYRAG 1 cut(s) 57
Sse9I AATT 3 cut(s) 11, 35, 63
SspMI CTAG 1 cut(s) 75
StyD4I CCNGG 1 cut(s) 193
TaaI ACNGT 1 cut(s) 160
TaqI TCGA 1 cut(s) 58
TasI AATT 3 cut(s) 11, 35, 63
TscAI CASTG 1 cut(s) 186
TspDTI ATGAA 1 cut(s) 24
TspRI CASTG 1 cut(s) 186
XapI RAATTY 1 cut(s) 35
XhoI CTCGAG 1 cut(s) 57
XspI CTAG 1 cut(s) 75
Zsp2I ATGCAT 1 cut(s) 49
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.