Rh1CG149700
ERF Family

Belongs to the small GTPase superfamily. Rho family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
Physical Location & Seq
Reverse (-)
33020358 .. 33021230
873 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG149700.1

Sequence Viewer

Length: 165 bp
ATGCTAATCTCTTATACCAGCAATAGCTTCCCCACTGTAAAAAGCAAGGATTATGTGCCTACAGTGTTTGACAACATCAGTGCTAATTTGGTGGCGGATGCACAGTTAACCTTGGATTGTGGGACACTGCAGGCTGAGCATCTTGCTGGGATAATCTTGTCCTAG
Functional Annotation
Pfam Domains
Protein Families

Protein Analysis

54

Amino Acids

5.79

Weight (kDa)

4.35

Isoelectric Point (pI)

28.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024778)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0339251
rosa_roxburghii Rroxscaffold_5G00351850
rosa_samantha Rh1CG149700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 95
AluBI AGCT 1 cut(s) 27
AluI AGCT 1 cut(s) 27
BfaI CTAG 1 cut(s) 163
BfmI CTRYAG 2 cut(s) 60, 128
BlpI GCTNAGC 1 cut(s) 135
BmsI GCATC 2 cut(s) 88, 148
Bpu1102I GCTNAGC 1 cut(s) 135
BsaJI CCNNGG 1 cut(s) 111
BseDI CCNNGG 1 cut(s) 111
BseGI GGATG 1 cut(s) 103
BseMII CTCAG 1 cut(s) 126
BseYI CCCAGC 1 cut(s) 146
BslFI GGGAC 1 cut(s) 136
BsmFI GGGAC 1 cut(s) 136
Bsp1720I GCTNAGC 1 cut(s) 135
BspACI CCGC 1 cut(s) 95
BspCNI CTCAG 1 cut(s) 127
BspMAI CTGCAG 1 cut(s) 132
BssECI CCNNGG 1 cut(s) 111
BssT1I CCWWGG 1 cut(s) 111
Bst4CI ACNGT 3 cut(s) 37, 64, 105
BstC8I GCNNGC 1 cut(s) 132
BstDEI CTNAG 1 cut(s) 135
BstF5I GGATG 1 cut(s) 103
BstMWI GCNNNNNNNGC 1 cut(s) 136
BstSFI CTRYAG 2 cut(s) 60, 128
BtsCI GGATG 1 cut(s) 103
BtsI GCAGTG 1 cut(s) 125
BtsIMutI CAGTG 4 cut(s) 33, 69, 85, 125
Cac8I GCNNGC 1 cut(s) 132
CviJI RGCY 2 cut(s) 27, 134
CviKI_1 RGCY 2 cut(s) 27, 134
DdeI CTNAG 1 cut(s) 135
EciI GGCGGA 1 cut(s) 110
Eco130I CCWWGG 1 cut(s) 111
EcoT14I CCWWGG 1 cut(s) 111
ErhI CCWWGG 1 cut(s) 111
FaiI YATR 2 cut(s) 15, 54
FaqI GGGAC 1 cut(s) 136
FokI GGATG 1 cut(s) 110
FspBI CTAG 1 cut(s) 163
GsaI CCCAGC 1 cut(s) 150
HincII GTYRAC 1 cut(s) 108
HindII GTYRAC 1 cut(s) 108
HpaI GTTAAC 1 cut(s) 108
Hpy166II GTNNAC 1 cut(s) 108
Hpy8I GTNNAC 1 cut(s) 108
HpyCH4III ACNGT 3 cut(s) 37, 64, 105
HpyCH4V TGCA 2 cut(s) 101, 130
HpyF10VI GCNNNNNNNGC 1 cut(s) 136
HpyF3I CTNAG 1 cut(s) 135
KspAI GTTAAC 1 cut(s) 108
LpnPI CCDG 3 cut(s) 31, 116, 132
LweI GCATC 2 cut(s) 88, 148
MaeI CTAG 1 cut(s) 163
MluCI AATT 1 cut(s) 85
MseI TTAA 1 cut(s) 107
MwoI GCNNNNNNNGC 1 cut(s) 136
PspFI CCCAGC 1 cut(s) 146
PstI CTGCAG 1 cut(s) 132
SaqAI TTAA 1 cut(s) 107
SetI ASST 2 cut(s) 29, 113
SfaNI GCATC 2 cut(s) 88, 148
SfcI CTRYAG 2 cut(s) 60, 128
SgeI CNNG 6 cut(s) 30, 58, 124, 143, 155, 159
Sse9I AATT 1 cut(s) 85
SsiI CCGC 1 cut(s) 95
SspMI CTAG 1 cut(s) 163
StyI CCWWGG 1 cut(s) 111
TaaI ACNGT 3 cut(s) 37, 64, 105
TasI AATT 1 cut(s) 85
Tru1I TTAA 1 cut(s) 107
Tru9I TTAA 1 cut(s) 107
TscAI CASTG 4 cut(s) 40, 69, 85, 132
TspRI CASTG 4 cut(s) 40, 69, 85, 132
XspI CTAG 1 cut(s) 163
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.