Rh1CG381000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
Physical Location & Seq
Forward (+)
65072484 .. 65077588
5105 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG381000.1

Sequence Viewer

Length: 360 bp
ATGTCGACAGTCATCGGAATCTGGGACTCCGGTCCAACCGTAACTTGTGGCAGAACGGTTGATGTTGACGATGTTGTAATCGGAATAGTGGCGTTGCGAATTCTAATCATGGAGGATTGTGGATTGTGTTATGATAAAGAGGAAAGGAGGAAACGAAAAGGGAGTCTGGCAAAGTATCAATCGTACAATGTTATCAAAGGTGATCACATCTTACAACCAGTGATAGCATTCGAACCTCATCCTTCCATCACAGAAAGGGAGAATCGTATCAAGATGACCTACAGTATATACGGAATAGTGGCTTTGCGAATTCTAAGCATGGAGAGTTGTAGATTGTGGTCTCTACAGGGAAAGGGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

119

Amino Acids

13.42

Weight (kDa)

8.38

Isoelectric Point (pI)

54.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0026204)

Species Orthologous Gene IDs
rosa_samantha Rh1AG404600 Rh1CG381000 Rh1DG398000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 5
AcsI RAATTY 2 cut(s) 99, 309
AfaI GTAC 1 cut(s) 185
Alw26I GTCTC 1 cut(s) 345
ApoI RAATTY 2 cut(s) 99, 309
ArsI GACNNNNNNTTYG 2 cut(s) 148, 180
AspS9I GGNCC 1 cut(s) 32
AsuHPI GGTGA 1 cut(s) 212
AsuII TTCGAA 1 cut(s) 231
AvaII GGWCC 1 cut(s) 32
BccI CCATC 1 cut(s) 254
BclI TGATCA 1 cut(s) 202
BcoDI GTCTC 1 cut(s) 345
BfmI CTRYAG 2 cut(s) 280, 344
Bme18I GGWCC 1 cut(s) 32
BmgT120I GGNCC 1 cut(s) 32
BoxI GACNNNNGTC 1 cut(s) 30
Bpu14I TTCGAA 1 cut(s) 231
BsaI GGTCTC 1 cut(s) 345
BsaWI WCCGGW 1 cut(s) 29
Bse1I ACTGG 1 cut(s) 218
BseGI GGATG 1 cut(s) 238
BseNI ACTGG 1 cut(s) 218
BsiSI CCGG 1 cut(s) 30
BslFI GGGAC 1 cut(s) 38
BsmAI GTCTC 1 cut(s) 345
BsmFI GGGAC 1 cut(s) 38
BsmI GAATGC 1 cut(s) 227
Bso31I GGTCTC 1 cut(s) 345
Bsp119I TTCGAA 1 cut(s) 231
Bsp143I GATC 1 cut(s) 202
BspT104I TTCGAA 1 cut(s) 231
BspTNI GGTCTC 1 cut(s) 345
BsrI ACTGG 1 cut(s) 218
BssMI GATC 1 cut(s) 202
Bst4CI ACNGT 4 cut(s) 10, 40, 58, 284
BstBI TTCGAA 1 cut(s) 231
BstDEI CTNAG 1 cut(s) 314
BstF5I GGATG 1 cut(s) 238
BstKTI GATC 1 cut(s) 205
BstMAI GTCTC 1 cut(s) 345
BstMBI GATC 1 cut(s) 202
BstPAI GACNNNNGTC 1 cut(s) 30
BstSFI CTRYAG 2 cut(s) 280, 344
BtsCI GGATG 1 cut(s) 238
BtsIMutI CAGTG 1 cut(s) 225
Cfr13I GGNCC 1 cut(s) 32
Csp6I GTAC 1 cut(s) 184
CviAII CATG 2 cut(s) 109, 319
CviJI RGCY 1 cut(s) 302
CviKI_1 RGCY 1 cut(s) 302
CviQI GTAC 1 cut(s) 184
DdeI CTNAG 1 cut(s) 314
DpnI GATC 1 cut(s) 204
DpnII GATC 1 cut(s) 202
Eco31I GGTCTC 1 cut(s) 345
Eco47I GGWCC 1 cut(s) 32
EcoRI GAATTC 2 cut(s) 99, 309
FaeI CATG 2 cut(s) 112, 322
FaiI YATR 5 cut(s) 110, 132, 287, 289, 320
FaqI GGGAC 1 cut(s) 38
FatI CATG 2 cut(s) 108, 318
FbaI TGATCA 1 cut(s) 202
FblI GTMKAC 1 cut(s) 5
FokI GGATG 1 cut(s) 225
HapII CCGG 1 cut(s) 30
Hin1II CATG 2 cut(s) 112, 322
HincII GTYRAC 2 cut(s) 6, 67
HindII GTYRAC 2 cut(s) 6, 67
HinfI GANTC 4 cut(s) 18, 26, 163, 262
HpaII CCGG 1 cut(s) 30
HphI GGTGA 1 cut(s) 212
Hpy166II GTNNAC 2 cut(s) 6, 67
Hpy188I TCNGA 2 cut(s) 17, 83
Hpy188III TCNNGA 1 cut(s) 271
Hpy8I GTNNAC 2 cut(s) 6, 67
HpyAV CCTTC 1 cut(s) 252
HpyCH4III ACNGT 4 cut(s) 10, 40, 58, 284
HpyF3I CTNAG 1 cut(s) 314
Hsp92II CATG 2 cut(s) 112, 322
Ksp22I TGATCA 1 cut(s) 202
Kzo9I GATC 1 cut(s) 202
LpnPI CCDG 5 cut(s) 7, 43, 152, 231, 332
MaeIII GTNAC 1 cut(s) 40
MalI GATC 1 cut(s) 204
MboI GATC 1 cut(s) 202
MluCI AATT 2 cut(s) 99, 309
MlyI GAGTC 2 cut(s) 20, 172
MmeI TCCRAC 1 cut(s) 59
MnlI CCTC 4 cut(s) 106, 133, 141, 246
MspI CCGG 1 cut(s) 30
Mva1269I GAATGC 1 cut(s) 227
NdeII GATC 1 cut(s) 202
NlaIII CATG 2 cut(s) 112, 322
NspV TTCGAA 1 cut(s) 231
PctI GAATGC 1 cut(s) 227
PfeI GAWTC 2 cut(s) 18, 262
PleI GAGTC 2 cut(s) 20, 171
PpsI GAGTC 2 cut(s) 20, 171
PshAI GACNNNNGTC 1 cut(s) 30
PspPI GGNCC 1 cut(s) 32
RsaI GTAC 1 cut(s) 185
RsaNI GTAC 1 cut(s) 184
SalI GTCGAC 1 cut(s) 4
Sau3AI GATC 1 cut(s) 202
Sau96I GGNCC 1 cut(s) 32
SchI GAGTC 2 cut(s) 20, 172
SetI ASST 3 cut(s) 202, 238, 281
SfcI CTRYAG 2 cut(s) 280, 344
SfuI TTCGAA 1 cut(s) 231
SgeI CNNG 8 cut(s) 34, 42, 57, 121, 179, 230, 283, 331
SinI GGWCC 1 cut(s) 32
Sse9I AATT 2 cut(s) 99, 309
TaaI ACNGT 4 cut(s) 10, 40, 58, 284
TaqI TCGA 2 cut(s) 5, 231
TasI AATT 2 cut(s) 99, 309
TfiI GAWTC 2 cut(s) 18, 262
TscAI CASTG 1 cut(s) 225
TspGWI ACGGA 1 cut(s) 306
TspRI CASTG 1 cut(s) 225
VpaK11BI GGWCC 1 cut(s) 32
XapI RAATTY 2 cut(s) 99, 309
XmiI GTMKAC 1 cut(s) 5
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.