Rh1CG421100
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
Physical Location & Seq
Reverse (-)
68042806 .. 68043425
620 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG421100.1

Sequence Viewer

Length: 210 bp
ATGAAACTTGGCCCAGTCAAAACAAAGATGCCTTCAGGACTGAGAAAGAGTATATGGAGTTGCATCTATGCTAGGCCTCAGTTGGTATTGGAATACAAAACTTATGCTACACCAAAACTTAGTGAAGACAAAGTTAGGCAGTGCATTGATGCAAGACTAGGAGGACATAGTGAAGACAAAGTTGGGCAGGATCAAATTTTGAATTTATAG

Protein Analysis

69

Amino Acids

7.8

Weight (kDa)

9.47

Isoelectric Point (pI)

57.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0034316)

Species Orthologous Gene IDs
rosa_samantha Rh1CG421100
rosa_wichuraiana Rw1G039290

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 198
AcsI RAATTY 2 cut(s) 195, 202
AcuI CTGAAG 1 cut(s) 18
AgsI TTSAA 1 cut(s) 202
AjuI GAANNNNNNNTTGG 2 cut(s) 165, 197
AlwI GGATC 1 cut(s) 198
AoxI GGCC 2 cut(s) 10, 74
ApoI RAATTY 2 cut(s) 195, 202
AspS9I GGNCC 1 cut(s) 11
BbsI GAAGAC 2 cut(s) 132, 180
BfaI CTAG 2 cut(s) 72, 158
BmgT120I GGNCC 1 cut(s) 11
BmrI ACTGGG 1 cut(s) 8
BmsI GCATC 3 cut(s) 18, 72, 139
BmuI ACTGGG 1 cut(s) 8
BpiI GAAGAC 2 cut(s) 132, 180
Bse1I ACTGG 1 cut(s) 14
BseMII CTCAG 2 cut(s) 32, 92
BseNI ACTGG 1 cut(s) 14
BshFI GGCC 2 cut(s) 12, 76
BsnI GGCC 2 cut(s) 12, 76
Bsp143I GATC 1 cut(s) 190
BspANI GGCC 2 cut(s) 12, 76
BspCNI CTCAG 2 cut(s) 33, 91
BspPI GGATC 1 cut(s) 198
BsrI ACTGG 1 cut(s) 14
BssMI GATC 1 cut(s) 190
BstDEI CTNAG 3 cut(s) 41, 78, 119
BstKTI GATC 1 cut(s) 193
BstMBI GATC 1 cut(s) 190
BstV2I GAAGAC 2 cut(s) 132, 180
BsuRI GGCC 2 cut(s) 12, 76
BtsI GCAGTG 1 cut(s) 146
BtsIMutI CAGTG 1 cut(s) 146
Cfr13I GGNCC 1 cut(s) 11
CviJI RGCY 2 cut(s) 12, 76
CviKI_1 RGCY 2 cut(s) 12, 76
DdeI CTNAG 3 cut(s) 41, 78, 119
DpnI GATC 1 cut(s) 192
DpnII GATC 1 cut(s) 190
Eco147I AGGCCT 1 cut(s) 76
Eco57I CTGAAG 1 cut(s) 18
FaiI YATR 6 cut(s) 53, 55, 69, 105, 168, 208
FspBI CTAG 2 cut(s) 72, 158
HaeIII GGCC 2 cut(s) 12, 76
Hpy188III TCNNGA 1 cut(s) 36
HpyAV CCTTC 1 cut(s) 42
HpyCH4V TGCA 3 cut(s) 63, 144, 152
HpyF3I CTNAG 3 cut(s) 41, 78, 119
Kzo9I GATC 1 cut(s) 190
LpnPI CCDG 3 cut(s) 21, 27, 173
LweI GCATC 3 cut(s) 18, 72, 139
MaeI CTAG 2 cut(s) 72, 158
MalI GATC 1 cut(s) 192
MboI GATC 1 cut(s) 190
MboII GAAGA 2 cut(s) 137, 185
MluCI AATT 2 cut(s) 195, 202
MnlI CCTC 2 cut(s) 87, 155
NdeII GATC 1 cut(s) 190
PceI AGGCCT 1 cut(s) 76
PspPI GGNCC 1 cut(s) 11
Sau3AI GATC 1 cut(s) 190
Sau96I GGNCC 1 cut(s) 11
SfaNI GCATC 3 cut(s) 18, 72, 139
SgeI CNNG 7 cut(s) 20, 26, 48, 84, 165, 170, 200
Sse9I AATT 2 cut(s) 195, 202
SseBI AGGCCT 1 cut(s) 76
SspMI CTAG 2 cut(s) 72, 158
StuI AGGCCT 1 cut(s) 76
TasI AATT 2 cut(s) 195, 202
TscAI CASTG 1 cut(s) 146
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 146
XapI RAATTY 2 cut(s) 195, 202
XspI CTAG 2 cut(s) 72, 158
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.