Rh1DG446400

Belongs to the NPH3 family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Reverse (-)
65500841 .. 65518541
17701 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG446400.1

Sequence Viewer

Length: 228 bp
ATGTATTCACAAAGAATATGGTCTCCAGAAGAACGCACGATGCACGACATTGATGTTGTTCAAAGGATTGTGGAATATTTCTTGATGCTTGAGCATCAACAGCAAGAGAGGACTGGTAAAACCAATATCAGTAAGCTCTTGGACAGCTACCTGGCTGAGATTGCAGGAGACCCAAACGCTTTCCTTATTGCTTTTCGATCACTTGCTGTGGATACATCATGTATTTGA

Protein Analysis

75

Amino Acids

8.73

Weight (kDa)

4.92

Isoelectric Point (pI)

53.11

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NPH3 PF03000 10 - 69 3.7e-12 NPH3 family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029465)

Species Orthologous Gene IDs
pyrus_communis pycom15g28580
rosa_samantha Rh1DG446400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 62
AjnI CCWGG 1 cut(s) 150
AluBI AGCT 2 cut(s) 136, 147
AluI AGCT 2 cut(s) 136, 147
Alw26I GTCTC 2 cut(s) 27, 162
BciT130I CCWGG 1 cut(s) 152
BciVI GTATCC 1 cut(s) 205
BcoDI GTCTC 2 cut(s) 27, 162
BfuI GTATCC 1 cut(s) 205
Bme1390I CCNGG 1 cut(s) 152
BmrFI CCNGG 1 cut(s) 152
BmsI GCATC 3 cut(s) 30, 75, 103
BpmI CTGGAG 1 cut(s) 9
BpuEI CTTGAG 1 cut(s) 110
BsaI GGTCTC 2 cut(s) 27, 162
Bse1I ACTGG 1 cut(s) 118
BseBI CCWGG 1 cut(s) 152
BseMII CTCAG 1 cut(s) 147
BseNI ACTGG 1 cut(s) 118
BsmAI GTCTC 2 cut(s) 27, 162
Bso31I GGTCTC 2 cut(s) 27, 162
Bsp143I GATC 1 cut(s) 197
BspCNI CTCAG 1 cut(s) 148
BspTNI GGTCTC 2 cut(s) 27, 162
BsrI ACTGG 1 cut(s) 118
BssMI GATC 1 cut(s) 197
Bst2UI CCWGG 1 cut(s) 152
BstDEI CTNAG 1 cut(s) 156
BstKTI GATC 1 cut(s) 200
BstMAI GTCTC 2 cut(s) 27, 162
BstMBI GATC 1 cut(s) 197
BstMWI GCNNNNNNNGC 2 cut(s) 100, 161
BstNI CCWGG 1 cut(s) 152
BstSCI CCNGG 1 cut(s) 150
BsuI GTATCC 1 cut(s) 205
CviAII CATG 1 cut(s) 219
CviJI RGCY 3 cut(s) 136, 147, 155
CviKI_1 RGCY 3 cut(s) 136, 147, 155
DdeI CTNAG 1 cut(s) 156
DpnI GATC 1 cut(s) 199
DpnII GATC 1 cut(s) 197
Eco31I GGTCTC 2 cut(s) 27, 162
EcoRII CCWGG 1 cut(s) 150
FaeI CATG 1 cut(s) 222
FaiI YATR 2 cut(s) 19, 220
FatI CATG 1 cut(s) 218
GsuI CTGGAG 1 cut(s) 9
Hin1II CATG 1 cut(s) 222
Hpy188III TCNNGA 2 cut(s) 26, 82
HpyCH4V TGCA 2 cut(s) 43, 164
HpyF10VI GCNNNNNNNGC 2 cut(s) 100, 161
HpyF3I CTNAG 1 cut(s) 156
Hsp92II CATG 1 cut(s) 222
Kzo9I GATC 1 cut(s) 197
LpnPI CCDG 5 cut(s) 39, 99, 137, 150, 164
LweI GCATC 3 cut(s) 30, 75, 103
MalI GATC 1 cut(s) 199
MboI GATC 1 cut(s) 197
MboII GAAGA 1 cut(s) 41
MnlI CCTC 1 cut(s) 102
MspR9I CCNGG 1 cut(s) 152
MvaI CCWGG 1 cut(s) 152
MwoI GCNNNNNNNGC 2 cut(s) 100, 161
NdeII GATC 1 cut(s) 197
NlaIII CATG 1 cut(s) 222
Psp6I CCWGG 1 cut(s) 150
PspGI CCWGG 1 cut(s) 150
Sau3AI GATC 1 cut(s) 197
ScrFI CCNGG 1 cut(s) 152
SetI ASST 3 cut(s) 138, 149, 153
SfaNI GCATC 3 cut(s) 30, 75, 103
SmlI CTYRAG 1 cut(s) 89
SmoI CTYRAG 1 cut(s) 89
SspI AATATT 1 cut(s) 77
StyD4I CCNGG 1 cut(s) 150
TaqI TCGA 1 cut(s) 196
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.