Rh2AG283000

G-type lectin S-receptor-like serine threonine-protein kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
OG0032522
Physical Location & Seq
Forward (+)
34406435 .. 34458914
52480 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG283000.1

Sequence Viewer

Length: 267 bp
ATGTTGGTAGCTAAACATGCAAAGAATGGTTCTCTTAGCAAGAAGGGAAAGCTGGCAATTACGATAACATCTATTTTAGTGTTCTTTGTTGTGATCTCTATCGCATATTGGTCCACAAAGATGAAGAGAAAAGCTAAACATGCAAAGAATGGTTCTCTTAGCAAGAAGGGAAAGCTGGCAATTACGATAACATCTATTTTAGTGTTCTTTCTTGTGATCTCTATCGCATATTGGTCCATAAAGATGAAGAGAAAAGCCCTAGCTTAG

Protein Analysis

88

Amino Acids

9.74

Weight (kDa)

11.13

Isoelectric Point (pI)

16.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0032522)

Species Orthologous Gene IDs
rosa_samantha Rh2AG283000 Rh3AG210100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 5 cut(s) 11, 52, 134, 175, 263
AluI AGCT 5 cut(s) 11, 52, 134, 175, 263
AspS9I GGNCC 2 cut(s) 111, 234
AvaII GGWCC 2 cut(s) 111, 234
BfaI CTAG 1 cut(s) 260
Bme18I GGWCC 2 cut(s) 111, 234
BmgT120I GGNCC 2 cut(s) 111, 234
BsaBI GATNNNNATC 2 cut(s) 98, 221
Bse8I GATNNNNATC 2 cut(s) 98, 221
BseJI GATNNNNATC 2 cut(s) 98, 221
Bsp143I GATC 2 cut(s) 93, 216
BssMI GATC 2 cut(s) 93, 216
Bst6I CTCTTC 2 cut(s) 119, 242
BstC8I GCNNGC 2 cut(s) 54, 177
BstDEI CTNAG 3 cut(s) 35, 158, 264
BstKTI GATC 2 cut(s) 96, 219
BstMBI GATC 2 cut(s) 93, 216
BstMWI GCNNNNNNNGC 2 cut(s) 17, 140
BstNSI RCATGY 2 cut(s) 20, 143
Cac8I GCNNGC 2 cut(s) 54, 177
Cfr13I GGNCC 2 cut(s) 111, 234
CviAII CATG 2 cut(s) 17, 140
CviJI RGCY 6 cut(s) 11, 52, 134, 175, 257, 263
CviKI_1 RGCY 6 cut(s) 11, 52, 134, 175, 257, 263
DdeI CTNAG 3 cut(s) 35, 158, 264
DpnI GATC 2 cut(s) 95, 218
DpnII GATC 2 cut(s) 93, 216
Eam1104I CTCTTC 2 cut(s) 119, 242
EarI CTCTTC 2 cut(s) 119, 242
Eco47I GGWCC 2 cut(s) 111, 234
FaeI CATG 2 cut(s) 20, 143
FaiI YATR 5 cut(s) 18, 106, 141, 229, 239
FatI CATG 2 cut(s) 16, 139
FspBI CTAG 1 cut(s) 260
Hin1II CATG 2 cut(s) 20, 143
Hpy166II GTNNAC 1 cut(s) 114
Hpy8I GTNNAC 1 cut(s) 114
HpyAV CCTTC 2 cut(s) 37, 160
HpyCH4V TGCA 2 cut(s) 20, 143
HpyF10VI GCNNNNNNNGC 2 cut(s) 17, 140
HpyF3I CTNAG 3 cut(s) 35, 158, 264
Hsp92II CATG 2 cut(s) 20, 143
Kzo9I GATC 2 cut(s) 93, 216
LpnPI CCDG 2 cut(s) 38, 161
MaeI CTAG 1 cut(s) 260
MalI GATC 2 cut(s) 95, 218
MboI GATC 2 cut(s) 93, 216
MboII GAAGA 2 cut(s) 136, 259
MluCI AATT 2 cut(s) 57, 180
MslI CAYNNNNRTG 2 cut(s) 119, 242
MwoI GCNNNNNNNGC 2 cut(s) 17, 140
NdeII GATC 2 cut(s) 93, 216
NlaIII CATG 2 cut(s) 20, 143
NspI RCATGY 2 cut(s) 20, 143
PspPI GGNCC 2 cut(s) 111, 234
RseI CAYNNNNRTG 2 cut(s) 119, 242
Sau3AI GATC 2 cut(s) 93, 216
Sau96I GGNCC 2 cut(s) 111, 234
SetI ASST 5 cut(s) 13, 54, 136, 177, 265
SgeI CNNG 7 cut(s) 29, 52, 65, 152, 175, 188, 224
SinI GGWCC 2 cut(s) 111, 234
SmiMI CAYNNNNRTG 2 cut(s) 119, 242
Sse9I AATT 2 cut(s) 57, 180
SspMI CTAG 1 cut(s) 260
TasI AATT 2 cut(s) 57, 180
TspDTI ATGAA 2 cut(s) 137, 260
VpaK11BI GGWCC 2 cut(s) 111, 234
XceI RCATGY 2 cut(s) 20, 143
XspI CTAG 1 cut(s) 260
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.