Rh2BG228000

Belongs to the cation transport ATPase (P-type) (TC 3.A.3) family. Type IV subfamily

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Reverse (-)
22309855 .. 22311765
1911 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG228000.1

Sequence Viewer

Length: 153 bp
ATGAAGGGTTTTGCTATGGGACAAGGTGCTAATGATGTTTTGATGATCCAAATCGTTGATGTAGGAGTTGGGATCAGTGGACAAGAGGCTCGACAAGCTGTCATGGCTTCAGATTTTGCAATGGAGCAGTTCAGATTCTTAGTTCCTTTCTAG

Protein Analysis

50

Amino Acids

5.41

Weight (kDa)

4.44

Isoelectric Point (pI)

15.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024634)

Species Orthologous Gene IDs
pyrus_communis pycom04g15500 pycom12g17720
rosa_samantha Rh2BG228000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 40, 80
AcuI CTGAAG 1 cut(s) 93
AhdI GACNNNNNGTC 1 cut(s) 98
AluBI AGCT 1 cut(s) 98
AluI AGCT 1 cut(s) 98
AlwI GGATC 2 cut(s) 40, 80
BfaI CTAG 1 cut(s) 151
BmeRI GACNNNNNGTC 1 cut(s) 98
BsaBI GATNNNNATC 1 cut(s) 50
Bse3DI GCAATG 1 cut(s) 126
Bse8I GATNNNNATC 1 cut(s) 50
BseJI GATNNNNATC 1 cut(s) 50
BseMI GCAATG 1 cut(s) 126
BslFI GGGAC 1 cut(s) 33
BsmFI GGGAC 1 cut(s) 33
Bsp143I GATC 2 cut(s) 45, 72
BspPI GGATC 2 cut(s) 40, 80
BsrDI GCAATG 1 cut(s) 126
BssMI GATC 2 cut(s) 45, 72
BstDEI CTNAG 1 cut(s) 139
BstKTI GATC 2 cut(s) 48, 75
BstMBI GATC 2 cut(s) 45, 72
BstMWI GCNNNNNNNGC 2 cut(s) 95, 104
BtsIMutI CAGTG 1 cut(s) 82
CviAII CATG 1 cut(s) 103
CviJI RGCY 3 cut(s) 89, 98, 107
CviKI_1 RGCY 3 cut(s) 89, 98, 107
DdeI CTNAG 1 cut(s) 139
DpnI GATC 2 cut(s) 47, 74
DpnII GATC 2 cut(s) 45, 72
DriI GACNNNNNGTC 1 cut(s) 98
Eam1105I GACNNNNNGTC 1 cut(s) 98
Eco57I CTGAAG 1 cut(s) 93
FaeI CATG 1 cut(s) 106
FaiI YATR 2 cut(s) 17, 104
FaqI GGGAC 1 cut(s) 33
FatI CATG 1 cut(s) 102
FspBI CTAG 1 cut(s) 151
Hin1II CATG 1 cut(s) 106
HinfI GANTC 1 cut(s) 135
Hpy166II GTNNAC 1 cut(s) 80
Hpy188I TCNGA 2 cut(s) 112, 134
Hpy8I GTNNAC 1 cut(s) 80
HpyCH4V TGCA 1 cut(s) 119
HpyF10VI GCNNNNNNNGC 2 cut(s) 95, 104
HpyF3I CTNAG 1 cut(s) 139
Hsp92II CATG 1 cut(s) 106
Kzo9I GATC 2 cut(s) 45, 72
LmnI GCTCC 1 cut(s) 124
MaeI CTAG 1 cut(s) 151
MalI GATC 2 cut(s) 47, 74
MboI GATC 2 cut(s) 45, 72
MnlI CCTC 1 cut(s) 79
MwoI GCNNNNNNNGC 2 cut(s) 95, 104
NdeII GATC 2 cut(s) 45, 72
NlaIII CATG 1 cut(s) 106
PfeI GAWTC 1 cut(s) 135
Sau3AI GATC 2 cut(s) 45, 72
SetI ASST 2 cut(s) 28, 100
SgeI CNNG 5 cut(s) 35, 95, 102, 107, 115
SspMI CTAG 1 cut(s) 151
TaqI TCGA 1 cut(s) 91
TfiI GAWTC 1 cut(s) 135
TscAI CASTG 1 cut(s) 82
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 82
XspI CTAG 1 cut(s) 151
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.