Rh2BG239300

disease resistance

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
OG0022873
Physical Location & Seq
Reverse (-)
23870923 .. 23871306
384 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG239300.1

Sequence Viewer

Length: 384 bp
ATGTATGAACTGAAGAATTCTAATGCTCACAGGATCGGGGTGTATGGAGTTGGAGGTGTGGGTAAAATTCCACTTGCCAAAGAAGTTTATAGGCAAGCTCGAGAAAATAAAATGTTATTTGATGATGTGGTTATTCTCCTAGATGTCAAGAGAAATCCAGACCTGGGAGTAATTCAGAGCAAGATTGTTCGTCAGTTAGGTATGAAGATTATTGACAATGAGAATTTAGATGGAAGAGCAAGTCGTCTATGTGCCAGGATACTAGACAAGAAGATTCTTGTGATTCTGGATGATGTTTGGGAACAAATTGACTTGGATGCTCTGGGACTTCCTAGTCTCCCTACTTGCAAGATATTTCTAACGTCTGGAAGTAAAGAAGCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04626 map04626
Pfam Domains
Protein Families
LRR_8 NB-ARC

Protein Analysis

127

Amino Acids

14.18

Weight (kDa)

8.56

Isoelectric Point (pI)

28.76

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NB-ARC PF00931 6 - 125 2.9e-18 NB-ARC domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022873)

Species Orthologous Gene IDs
rosa_laevigata RLG00000009454
rosa_samantha Rh2AG227400 Rh2BG239300 Rh2DG235500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 333
AclWI GGATC 1 cut(s) 41
AcsI RAATTY 3 cut(s) 16, 66, 223
AcuI CTGAAG 1 cut(s) 32
AfiI CCNNNNNNNGG 1 cut(s) 164
AjnI CCWGG 2 cut(s) 162, 254
AluBI AGCT 1 cut(s) 98
AluI AGCT 1 cut(s) 98
Alw26I GTCTC 1 cut(s) 341
AlwI GGATC 1 cut(s) 41
Ama87I CYCGRG 1 cut(s) 99
ApoI RAATTY 3 cut(s) 16, 66, 223
AvaI CYCGRG 1 cut(s) 99
BccI CCATC 1 cut(s) 224
BciT130I CCWGG 2 cut(s) 164, 256
BciVI GTATCC 1 cut(s) 252
BcoDI GTCTC 1 cut(s) 341
BfaI CTAG 3 cut(s) 140, 263, 333
BfuI GTATCC 1 cut(s) 252
Bme1390I CCNGG 2 cut(s) 164, 256
BmeT110I CYCGRG 1 cut(s) 99
BmrFI CCNGG 2 cut(s) 164, 256
BmsI GCATC 1 cut(s) 307
BsaJI CCNNGG 1 cut(s) 163
Bsc4I CCNNNNNNNGG 1 cut(s) 164
BseBI CCWGG 2 cut(s) 164, 256
BseDI CCNNGG 1 cut(s) 163
BseGI GGATG 2 cut(s) 295, 322
BseLI CCNNNNNNNGG 1 cut(s) 164
BsiHKCI CYCGRG 1 cut(s) 99
BslFI GGGAC 1 cut(s) 339
BslI CCNNNNNNNGG 1 cut(s) 164
BsmAI GTCTC 1 cut(s) 341
BsmFI GGGAC 1 cut(s) 339
BsoBI CYCGRG 1 cut(s) 99
Bsp143I GATC 1 cut(s) 33
BspPI GGATC 1 cut(s) 41
BspQI GCTCTTC 1 cut(s) 229
BssECI CCNNGG 1 cut(s) 163
BssMI GATC 1 cut(s) 33
Bst2UI CCWGG 2 cut(s) 164, 256
Bst6I CTCTTC 1 cut(s) 229
BstC8I GCNNGC 1 cut(s) 96
BstF5I GGATG 2 cut(s) 295, 322
BstKTI GATC 1 cut(s) 36
BstMAI GTCTC 1 cut(s) 341
BstMBI GATC 1 cut(s) 33
BstNI CCWGG 2 cut(s) 164, 256
BstSCI CCNGG 2 cut(s) 162, 254
BsuI GTATCC 1 cut(s) 252
BtsCI GGATG 2 cut(s) 295, 322
Cac8I GCNNGC 1 cut(s) 96
CviJI RGCY 1 cut(s) 98
CviKI_1 RGCY 1 cut(s) 98
DpnI GATC 1 cut(s) 35
DpnII GATC 1 cut(s) 33
DrdI GACNNNNNNGTC 1 cut(s) 333
DseDI GACNNNNNNGTC 1 cut(s) 333
Eam1104I CTCTTC 1 cut(s) 229
EarI CTCTTC 1 cut(s) 229
Eco57I CTGAAG 1 cut(s) 32
Eco88I CYCGRG 1 cut(s) 99
EcoRI GAATTC 1 cut(s) 16
EcoRII CCWGG 2 cut(s) 162, 254
FaiI YATR 6 cut(s) 6, 45, 90, 203, 250, 382
FaqI GGGAC 1 cut(s) 339
FokI GGATG 2 cut(s) 302, 329
FspBI CTAG 3 cut(s) 140, 263, 333
HinfI GANTC 2 cut(s) 274, 283
Hpy188I TCNGA 1 cut(s) 177
Hpy188III TCNNGA 5 cut(s) 101, 148, 158, 287, 366
HpyCH4IV ACGT 1 cut(s) 362
HpyCH4V TGCA 1 cut(s) 348
HpySE526I ACGT 1 cut(s) 362
Kzo9I GATC 1 cut(s) 33
LguI GCTCTTC 1 cut(s) 229
LpnPI CCDG 9 cut(s) 16, 149, 171, 176, 241, 268, 272, 308, 351
LweI GCATC 1 cut(s) 307
MaeI CTAG 3 cut(s) 140, 263, 333
MaeII ACGT 1 cut(s) 362
MalI GATC 1 cut(s) 35
MboI GATC 1 cut(s) 33
MboII GAAGA 4 cut(s) 25, 217, 246, 283
MluCI AATT 5 cut(s) 16, 66, 171, 223, 306
MmeI TCCRAC 1 cut(s) 31
MnlI CCTC 1 cut(s) 47
MspR9I CCNGG 2 cut(s) 164, 256
MvaI CCWGG 2 cut(s) 164, 256
NdeII GATC 1 cut(s) 33
PaeR7I CTCGAG 1 cut(s) 99
PciSI GCTCTTC 1 cut(s) 229
PfeI GAWTC 2 cut(s) 274, 283
Psp6I CCWGG 2 cut(s) 162, 254
PspGI CCWGG 2 cut(s) 162, 254
SapI GCTCTTC 1 cut(s) 229
Sau3AI GATC 1 cut(s) 33
ScrFI CCNGG 2 cut(s) 164, 256
SetI ASST 5 cut(s) 58, 100, 165, 202, 365
SfaNI GCATC 1 cut(s) 307
Sfr274I CTCGAG 1 cut(s) 99
SlaI CTCGAG 1 cut(s) 99
SmlI CTYRAG 1 cut(s) 99
SmoI CTYRAG 1 cut(s) 99
Sse9I AATT 5 cut(s) 16, 66, 171, 223, 306
SspMI CTAG 3 cut(s) 140, 263, 333
StyD4I CCNGG 2 cut(s) 162, 254
TaiI ACGT 1 cut(s) 365
TaqI TCGA 1 cut(s) 100
TasI AATT 5 cut(s) 16, 66, 171, 223, 306
TfiI GAWTC 2 cut(s) 274, 283
TspDTI ATGAA 2 cut(s) 21, 218
XapI RAATTY 3 cut(s) 16, 66, 223
XhoI CTCGAG 1 cut(s) 99
XspI CTAG 3 cut(s) 140, 263, 333
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.