Rh2CG320000

Omega-6 fatty acid desaturase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Forward (+)
41059852 .. 41064977
5126 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG320000.1

Sequence Viewer

Length: 306 bp
ATGGCCCAAGGTGTCTTCCAGTTGAGAAGAAGCTGGATTGAGATCCTCTGCCATGATATCAATGTCCATATTCCCCATCATATGTCTCCAAGGATTCCAAGCTATAACTTAGGGGGGCAACATGAACCTCTGTTTGGTTCATATGTTCCACACGAGAATGTTAATTATCCTTATAATTTGCCTATTCCAAGCTTCAACATGACCTGTTCAGAGATGGACCCTGTCAATGACAATGCTCAAGAAGTTCAAAATGCTCAAGGTGATCTTGTTGAAAATAATGAGAATGTGATGCATGATTACCAATAA

Protein Analysis

101

Amino Acids

11.64

Weight (kDa)

4.89

Isoelectric Point (pI)

68.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029983)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr3g0496941
rosa_samantha Rh2CG320000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 174
AclWI GGATC 1 cut(s) 37
AfiI CCNNNNNNNGG 1 cut(s) 134
AgsI TTSAA 3 cut(s) 196, 248, 272
AjuI GAANNNNNNNTTGG 2 cut(s) 117, 149
AluBI AGCT 3 cut(s) 33, 102, 192
AluI AGCT 3 cut(s) 33, 102, 192
Alw26I GTCTC 1 cut(s) 90
AlwI GGATC 1 cut(s) 37
AoxI GGCC 1 cut(s) 3
AspS9I GGNCC 2 cut(s) 4, 217
AsuHPI GGTGA 1 cut(s) 272
AvaII GGWCC 1 cut(s) 217
BauI CACGAG 1 cut(s) 152
BbsI GAAGAC 1 cut(s) 7
BccI CCATC 2 cut(s) 84, 208
BcoDI GTCTC 1 cut(s) 90
Bme18I GGWCC 1 cut(s) 217
BmgT120I GGNCC 2 cut(s) 4, 217
BmiI GGNNCC 1 cut(s) 219
BmsI GCATC 1 cut(s) 279
BpiI GAAGAC 1 cut(s) 7
BpuEI CTTGAG 2 cut(s) 222, 240
BsaBI GATNNNNATC 1 cut(s) 41
BsaJI CCNNGG 2 cut(s) 7, 89
Bsc4I CCNNNNNNNGG 1 cut(s) 134
Bse1I ACTGG 1 cut(s) 19
Bse8I GATNNNNATC 1 cut(s) 41
BseDI CCNNGG 2 cut(s) 7, 89
BseJI GATNNNNATC 1 cut(s) 41
BseLI CCNNNNNNNGG 1 cut(s) 134
BseNI ACTGG 1 cut(s) 19
BshFI GGCC 1 cut(s) 5
BslI CCNNNNNNNGG 1 cut(s) 134
BsmAI GTCTC 1 cut(s) 90
BsnI GGCC 1 cut(s) 5
Bsp143I GATC 2 cut(s) 42, 262
BspANI GGCC 1 cut(s) 5
BspLI GGNNCC 1 cut(s) 219
BspPI GGATC 1 cut(s) 37
BsrI ACTGG 1 cut(s) 19
BssECI CCNNGG 2 cut(s) 7, 89
BssMI GATC 2 cut(s) 42, 262
BssSI CACGAG 1 cut(s) 152
BssT1I CCWWGG 2 cut(s) 7, 89
Bst2BI CACGAG 1 cut(s) 152
BstDEI CTNAG 1 cut(s) 109
BstKTI GATC 2 cut(s) 45, 265
BstMAI GTCTC 1 cut(s) 90
BstMBI GATC 2 cut(s) 42, 262
BstV2I GAAGAC 1 cut(s) 7
BstX2I RGATCY 1 cut(s) 42
BstYI RGATCY 1 cut(s) 42
BsuRI GGCC 1 cut(s) 5
Cfr13I GGNCC 2 cut(s) 4, 217
CviAII CATG 4 cut(s) 53, 122, 199, 293
CviJI RGCY 4 cut(s) 5, 33, 102, 192
CviKI_1 RGCY 4 cut(s) 5, 33, 102, 192
DdeI CTNAG 1 cut(s) 109
DpnI GATC 2 cut(s) 44, 264
DpnII GATC 2 cut(s) 42, 262
Eco130I CCWWGG 2 cut(s) 7, 89
Eco32I GATATC 1 cut(s) 58
Eco47I GGWCC 1 cut(s) 217
EcoRV GATATC 1 cut(s) 58
EcoT14I CCWWGG 2 cut(s) 7, 89
EcoT22I ATGCAT 1 cut(s) 294
ErhI CCWWGG 2 cut(s) 7, 89
FaeI CATG 4 cut(s) 56, 125, 202, 296
FalI AAGNNNNNCTT 2 cut(s) 249, 281
FatI CATG 4 cut(s) 52, 121, 198, 292
FauNDI CATATG 2 cut(s) 81, 142
HaeIII GGCC 1 cut(s) 5
Hin1II CATG 4 cut(s) 56, 125, 202, 296
HindIII AAGCTT 1 cut(s) 190
HinfI GANTC 1 cut(s) 94
HphI GGTGA 1 cut(s) 272
Hpy188I TCNGA 1 cut(s) 211
Hpy188III TCNNGA 1 cut(s) 239
HpyCH4V TGCA 1 cut(s) 292
HpyF3I CTNAG 1 cut(s) 109
Hsp92II CATG 4 cut(s) 56, 125, 202, 296
Kzo9I GATC 2 cut(s) 42, 262
LpnPI CCDG 4 cut(s) 19, 32, 217, 234
LweI GCATC 1 cut(s) 279
MalI GATC 2 cut(s) 44, 264
MboI GATC 2 cut(s) 42, 262
MboII GAAGA 2 cut(s) 7, 39
MflI RGATCY 1 cut(s) 42
MluCI AATT 2 cut(s) 163, 175
MnlI CCTC 2 cut(s) 56, 138
Mph1103I ATGCAT 1 cut(s) 294
MseI TTAA 1 cut(s) 162
MslI CAYNNNNRTG 1 cut(s) 156
NdeI CATATG 2 cut(s) 81, 142
NdeII GATC 2 cut(s) 42, 262
NlaIII CATG 4 cut(s) 56, 125, 202, 296
NlaIV GGNNCC 1 cut(s) 219
NsiI ATGCAT 1 cut(s) 294
PfeI GAWTC 1 cut(s) 94
PflFI GACNNNGTC 1 cut(s) 221
PsiI TTATAA 1 cut(s) 174
PspN4I GGNNCC 1 cut(s) 219
PspPI GGNCC 2 cut(s) 4, 217
PsuI RGATCY 1 cut(s) 42
PsyI GACNNNGTC 1 cut(s) 221
RseI CAYNNNNRTG 1 cut(s) 156
SaqAI TTAA 1 cut(s) 162
Sau3AI GATC 2 cut(s) 42, 262
Sau96I GGNCC 2 cut(s) 4, 217
SetI ASST 7 cut(s) 13, 35, 104, 130, 194, 206, 262
SfaNI GCATC 1 cut(s) 279
SinI GGWCC 1 cut(s) 217
SmiMI CAYNNNNRTG 1 cut(s) 156
SmlI CTYRAG 2 cut(s) 237, 255
SmoI CTYRAG 2 cut(s) 237, 255
Sse9I AATT 2 cut(s) 163, 175
StyI CCWWGG 2 cut(s) 7, 89
TasI AATT 2 cut(s) 163, 175
TfiI GAWTC 1 cut(s) 94
Tru1I TTAA 1 cut(s) 162
Tru9I TTAA 1 cut(s) 162
TspDTI ATGAA 2 cut(s) 129, 138
Tth111I GACNNNGTC 1 cut(s) 221
VpaK11BI GGWCC 1 cut(s) 217
Zsp2I ATGCAT 1 cut(s) 294
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.