Rh2CG420800
TCP Family

assists the folding of proteins upon ATP hydrolysis

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Forward (+)
57428192 .. 57446165
17974 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG420800.1

Sequence Viewer

Length: 174 bp
ATGATAGCCCGTATTCTTCCTGGAACTGCAGCTACTGAAATAGAGTTAGCTAGGAGGGTGAAGGAATTCTCCTTGAAAGAAAGAGGGTTCTACTTTTGGTCCTGTATATTGCCATTGAGTACCACAACTTTGACAAACTCTTTCACCCTGAAATTCATCCAGCAAATTGATTAA

Protein Analysis

57

Amino Acids

6.57

Weight (kDa)

9.1

Isoelectric Point (pI)

53.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0034644)

Species Orthologous Gene IDs
rosa_samantha Rh2CG420800 Rh4CG039300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 65, 152
AfaI GTAC 1 cut(s) 121
AgsI TTSAA 1 cut(s) 76
AjnI CCWGG 1 cut(s) 19
AluBI AGCT 2 cut(s) 32, 50
AluI AGCT 2 cut(s) 32, 50
AlwNI CAGNNNCTG 1 cut(s) 35
ApeKI GCWGC 1 cut(s) 29
ApoI RAATTY 2 cut(s) 65, 152
Asp700I GAANNNNTTC 1 cut(s) 65
AspS9I GGNCC 1 cut(s) 99
AsuHPI GGTGA 2 cut(s) 70, 136
AvaII GGWCC 1 cut(s) 99
BbvI GCAGC 1 cut(s) 41
BciT130I CCWGG 1 cut(s) 21
BfaI CTAG 1 cut(s) 51
BfmI CTRYAG 1 cut(s) 27
BisI GCNGC 1 cut(s) 30
BlsI GCNGC 1 cut(s) 31
Bme1390I CCNGG 1 cut(s) 21
Bme18I GGWCC 1 cut(s) 99
BmgT120I GGNCC 1 cut(s) 99
BmrFI CCNGG 1 cut(s) 21
BseBI CCWGG 1 cut(s) 21
BseGI GGATG 1 cut(s) 156
BseXI GCAGC 1 cut(s) 41
BspMAI CTGCAG 1 cut(s) 31
Bst2UI CCWGG 1 cut(s) 21
BstF5I GGATG 1 cut(s) 156
BstNI CCWGG 1 cut(s) 21
BstSCI CCNGG 1 cut(s) 19
BstSFI CTRYAG 1 cut(s) 27
BstV1I GCAGC 1 cut(s) 41
BtsCI GGATG 1 cut(s) 156
CaiI CAGNNNCTG 1 cut(s) 35
Cfr13I GGNCC 1 cut(s) 99
Csp6I GTAC 1 cut(s) 120
CviJI RGCY 3 cut(s) 8, 32, 50
CviKI_1 RGCY 3 cut(s) 8, 32, 50
CviQI GTAC 1 cut(s) 120
Eco47I GGWCC 1 cut(s) 99
EcoRI GAATTC 1 cut(s) 65
EcoRII CCWGG 1 cut(s) 19
FaiI YATR 1 cut(s) 107
Fnu4HI GCNGC 1 cut(s) 30
FokI GGATG 1 cut(s) 143
Fsp4HI GCNGC 1 cut(s) 30
FspBI CTAG 1 cut(s) 51
GluI GCNGC 1 cut(s) 30
HphI GGTGA 2 cut(s) 70, 136
HpyAV CCTTC 1 cut(s) 55
HpyCH4V TGCA 1 cut(s) 29
LpnPI CCDG 4 cut(s) 6, 33, 115, 161
Lsp1109I GCAGC 1 cut(s) 41
MaeI CTAG 1 cut(s) 51
MboII GAAGA 1 cut(s) 8
MluCI AATT 3 cut(s) 65, 152, 165
MnlI CCTC 2 cut(s) 48, 77
MroXI GAANNNNTTC 1 cut(s) 65
MseI TTAA 1 cut(s) 172
MspR9I CCNGG 1 cut(s) 21
MvaI CCWGG 1 cut(s) 21
PdmI GAANNNNTTC 1 cut(s) 65
PfoI TCCNGGA 1 cut(s) 19
PkrI GCNGC 1 cut(s) 31
Psp6I CCWGG 1 cut(s) 19
PspGI CCWGG 1 cut(s) 19
PspPI GGNCC 1 cut(s) 99
PsrI GAACNNNNNNTAC 2 cut(s) 16, 48
PstI CTGCAG 1 cut(s) 31
PstNI CAGNNNCTG 1 cut(s) 35
RsaI GTAC 1 cut(s) 121
RsaNI GTAC 1 cut(s) 120
SaqAI TTAA 1 cut(s) 172
SatI GCNGC 1 cut(s) 30
Sau96I GGNCC 1 cut(s) 99
ScrFI CCNGG 1 cut(s) 21
SetI ASST 2 cut(s) 34, 52
SfcI CTRYAG 1 cut(s) 27
SgeI CNNG 7 cut(s) 21, 32, 33, 63, 85, 114, 160
SinI GGWCC 1 cut(s) 99
Sse9I AATT 3 cut(s) 65, 152, 165
SspMI CTAG 1 cut(s) 51
StyD4I CCNGG 1 cut(s) 19
TasI AATT 3 cut(s) 65, 152, 165
Tru1I TTAA 1 cut(s) 172
Tru9I TTAA 1 cut(s) 172
TseI GCWGC 1 cut(s) 29
TspDTI ATGAA 1 cut(s) 145
VpaK11BI GGWCC 1 cut(s) 99
XapI RAATTY 2 cut(s) 65, 152
XmnI GAANNNNTTC 1 cut(s) 65
XspI CTAG 1 cut(s) 51
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.