Rh2CG588800

PQQ enzyme repeat

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Forward (+)
76607503 .. 76607921
419 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG588800.1

Sequence Viewer

Length: 306 bp
ATGGAAGCCTTAGTTGTCTGGTCTGTGGAAGCAGGGCCTGGTGGTCTTGGCGGAGGAGGAACCTGGGGGGCAGCTACTGATAAGAAAAGAGTATACACGAATATTGGCTACTCGGATCACAAAAATTTCACTCTCAAACCATCAAATAATATAACAACCGCCGGGGGATGGGTTGCAATTAATCCTCGCAATGGGAAAGTCCTATGGACGACGGCTAATCCCAGCGATGGAACTTCTCCGGGGCCTGTTAGTGTGGCTAACGGTGTCTTATTTGCTGGATCGACAAGCCAACGAGGACCGATATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

101

Amino Acids

10.31

Weight (kDa)

9.6

Isoelectric Point (pI)

25.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029892)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0168961
rosa_samantha Rh2CG588800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 93
AciI CCGC 2 cut(s) 51, 159
AclWI GGATC 2 cut(s) 123, 286
AcsI RAATTY 1 cut(s) 124
AfiI CCNNNNNNNGG 3 cut(s) 168, 191, 227
AjnI CCWGG 2 cut(s) 37, 62
AluBI AGCT 1 cut(s) 74
AluI AGCT 1 cut(s) 74
AlwI GGATC 2 cut(s) 123, 286
AlwNI CAGNNNCTG 2 cut(s) 38, 77
AoxI GGCC 2 cut(s) 35, 242
ApeKI GCWGC 1 cut(s) 71
ApoI RAATTY 1 cut(s) 124
AseI ATTAAT 1 cut(s) 180
AspS9I GGNCC 3 cut(s) 35, 242, 296
AsuC2I CCSGG 2 cut(s) 163, 240
AvaII GGWCC 1 cut(s) 296
BbvI GCAGC 1 cut(s) 83
BccI CCATC 3 cut(s) 148, 162, 221
BceAI ACGGC 1 cut(s) 228
BciT130I CCWGG 2 cut(s) 39, 64
BcnI CCSGG 2 cut(s) 163, 240
BisI GCNGC 1 cut(s) 72
BlsI GCNGC 1 cut(s) 73
Bme1390I CCNGG 4 cut(s) 39, 64, 163, 240
Bme18I GGWCC 1 cut(s) 296
BmgT120I GGNCC 3 cut(s) 35, 242, 296
BmiI GGNNCC 2 cut(s) 61, 243
BmrFI CCNGG 4 cut(s) 39, 64, 163, 240
BpuMI CCSGG 2 cut(s) 163, 240
BsaJI CCNNGG 3 cut(s) 63, 162, 239
Bsc4I CCNNNNNNNGG 3 cut(s) 168, 191, 227
Bse3DI GCAATG 1 cut(s) 196
BseBI CCWGG 2 cut(s) 39, 64
BseDI CCNNGG 3 cut(s) 63, 162, 239
BseGI GGATG 1 cut(s) 173
BseLI CCNNNNNNNGG 3 cut(s) 168, 191, 227
BseMI GCAATG 1 cut(s) 196
BseRI GAGGAG 1 cut(s) 69
BseXI GCAGC 1 cut(s) 83
BseYI CCCAGC 1 cut(s) 221
BshFI GGCC 2 cut(s) 37, 244
BsiSI CCGG 2 cut(s) 162, 239
BslI CCNNNNNNNGG 3 cut(s) 168, 191, 227
BsnI GGCC 2 cut(s) 37, 244
Bsp143I GATC 2 cut(s) 115, 278
BspACI CCGC 2 cut(s) 51, 159
BspANI GGCC 2 cut(s) 37, 244
BspLI GGNNCC 2 cut(s) 61, 243
BspPI GGATC 2 cut(s) 123, 286
BsrDI GCAATG 1 cut(s) 196
BssECI CCNNGG 3 cut(s) 63, 162, 239
BssMI GATC 2 cut(s) 115, 278
BssNAI GTATAC 1 cut(s) 94
Bst1107I GTATAC 1 cut(s) 94
Bst2UI CCWGG 2 cut(s) 39, 64
Bst4CI ACNGT 1 cut(s) 263
BstDEI CTNAG 1 cut(s) 10
BstF5I GGATG 1 cut(s) 173
BstKTI GATC 2 cut(s) 118, 281
BstMBI GATC 2 cut(s) 115, 278
BstNI CCWGG 2 cut(s) 39, 64
BstSCI CCNGG 4 cut(s) 37, 62, 161, 238
BstV1I GCAGC 1 cut(s) 83
BstZ17I GTATAC 1 cut(s) 94
BsuRI GGCC 2 cut(s) 37, 244
BtgZI GCGATG 1 cut(s) 240
BtsCI GGATG 1 cut(s) 173
CaiI CAGNNNCTG 2 cut(s) 38, 77
Cfr13I GGNCC 3 cut(s) 35, 242, 296
CviJI RGCY 8 cut(s) 8, 37, 74, 108, 215, 244, 257, 288
CviKI_1 RGCY 8 cut(s) 8, 37, 74, 108, 215, 244, 257, 288
DdeI CTNAG 1 cut(s) 10
DpnI GATC 2 cut(s) 117, 280
DpnII GATC 2 cut(s) 115, 278
EciI GGCGGA 1 cut(s) 66
Eco47I GGWCC 1 cut(s) 296
EcoO109I RGGNCCY 2 cut(s) 35, 242
EcoRII CCWGG 2 cut(s) 37, 62
FaiI YATR 4 cut(s) 94, 152, 205, 304
FblI GTMKAC 1 cut(s) 93
Fnu4HI GCNGC 1 cut(s) 72
FokI GGATG 1 cut(s) 180
Fsp4HI GCNGC 1 cut(s) 72
GluI GCNGC 1 cut(s) 72
GsaI CCCAGC 1 cut(s) 225
HaeIII GGCC 2 cut(s) 37, 244
HapII CCGG 2 cut(s) 162, 239
HpaII CCGG 2 cut(s) 162, 239
Hpy166II GTNNAC 1 cut(s) 94
Hpy188I TCNGA 1 cut(s) 115
Hpy8I GTNNAC 1 cut(s) 94
Hpy99I CGWCG 1 cut(s) 214
HpyCH4III ACNGT 1 cut(s) 263
HpyCH4V TGCA 1 cut(s) 176
HpyF3I CTNAG 1 cut(s) 10
Kzo9I GATC 2 cut(s) 115, 278
Lsp1109I GCAGC 1 cut(s) 83
MalI GATC 2 cut(s) 117, 280
MboI GATC 2 cut(s) 115, 278
MluCI AATT 2 cut(s) 124, 177
MnlI CCTC 4 cut(s) 47, 50, 195, 287
MseI TTAA 1 cut(s) 180
MspI CCGG 2 cut(s) 162, 239
MspR9I CCNGG 4 cut(s) 39, 64, 163, 240
MvaI CCWGG 2 cut(s) 39, 64
NciI CCSGG 2 cut(s) 163, 240
NdeII GATC 2 cut(s) 115, 278
NlaIV GGNNCC 2 cut(s) 61, 243
PkrI GCNGC 1 cut(s) 73
PshBI ATTAAT 1 cut(s) 180
Psp6I CCWGG 2 cut(s) 37, 62
PspFI CCCAGC 1 cut(s) 221
PspGI CCWGG 2 cut(s) 37, 62
PspN4I GGNNCC 2 cut(s) 61, 243
PspPI GGNCC 3 cut(s) 35, 242, 296
PstNI CAGNNNCTG 2 cut(s) 38, 77
SaqAI TTAA 1 cut(s) 180
SatI GCNGC 1 cut(s) 72
Sau3AI GATC 2 cut(s) 115, 278
Sau96I GGNCC 3 cut(s) 35, 242, 296
ScrFI CCNGG 4 cut(s) 39, 64, 163, 240
SetI ASST 2 cut(s) 65, 76
SinI GGWCC 1 cut(s) 296
Sse9I AATT 2 cut(s) 124, 177
SsiI CCGC 2 cut(s) 51, 159
SspI AATATT 1 cut(s) 103
StyD4I CCNGG 4 cut(s) 37, 62, 161, 238
TaaI ACNGT 1 cut(s) 263
TaqI TCGA 1 cut(s) 281
TasI AATT 2 cut(s) 124, 177
Tru1I TTAA 1 cut(s) 180
Tru9I TTAA 1 cut(s) 180
TseI GCWGC 1 cut(s) 71
VpaK11BI GGWCC 1 cut(s) 296
VspI ATTAAT 1 cut(s) 180
XapI RAATTY 1 cut(s) 124
XmiI GTMKAC 1 cut(s) 93
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.