Rh2CG608400

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
OG0021559
Physical Location & Seq
Forward (+)
78403030 .. 78410253
7224 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG608400.1

Sequence Viewer

Length: 279 bp
ATGGATCCAGAACAAATGGTTTTGGGAGGTGACACCAGTTCAAAGCTAACTTCTATGTATACTTACTGTATCTGCCTTGATGTGGGTTTGAATGTTGGTTTTGAATGCAATAGGCCAATAGTTACTTATAGAATGCTTTGGTTAGCACATAAACTCGAGCACAGAAATAGTAAAGGCTGCAGCTATGGTTATCCATATTATCTTAAACAGGGCTTAAGAAGGTTGCGACGTGTCAAACATCGGATGATTCAGAACAAGAAAAACAAGAATAATGTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

92

Amino Acids

10.83

Weight (kDa)

9.77

Isoelectric Point (pI)

48.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021559)

Species Orthologous Gene IDs
rosa_laevigata RLG00000022022
rosa_samantha Rh2AG629300 Rh2CG608400 Rh2DG650700 Rh2DG656400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 59
AclWI GGATC 1 cut(s) 12
AfiI CCNNNNNNNGG 1 cut(s) 82
AflII CTTAAG 1 cut(s) 214
AflIII ACRYGT 1 cut(s) 229
AgsI TTSAA 3 cut(s) 42, 91, 104
AjiI CACGTC 1 cut(s) 230
AluBI AGCT 2 cut(s) 46, 183
AluI AGCT 2 cut(s) 46, 183
Alw21I GWGCWC 1 cut(s) 162
AlwI GGATC 1 cut(s) 12
Ama87I CYCGRG 1 cut(s) 155
AoxI GGCC 1 cut(s) 113
ApeKI GCWGC 2 cut(s) 177, 180
AsuHPI GGTGA 1 cut(s) 41
AvaI CYCGRG 1 cut(s) 155
BamHI GGATCC 1 cut(s) 4
Bbv12I GWGCWC 1 cut(s) 162
BbvI GCAGC 2 cut(s) 164, 192
BfmI CTRYAG 1 cut(s) 178
BfrI CTTAAG 1 cut(s) 214
BisI GCNGC 2 cut(s) 178, 181
BlsI GCNGC 2 cut(s) 179, 182
BmeT110I CYCGRG 1 cut(s) 155
BmgBI CACGTC 1 cut(s) 230
BmiI GGNNCC 1 cut(s) 6
Bsc4I CCNNNNNNNGG 1 cut(s) 82
Bse1I ACTGG 1 cut(s) 36
BseGI GGATG 1 cut(s) 249
BseLI CCNNNNNNNGG 1 cut(s) 82
BseNI ACTGG 1 cut(s) 36
BseXI GCAGC 2 cut(s) 164, 192
BshFI GGCC 1 cut(s) 115
BsiHKAI GWGCWC 1 cut(s) 162
BsiHKCI CYCGRG 1 cut(s) 155
BslI CCNNNNNNNGG 1 cut(s) 82
BsmI GAATGC 2 cut(s) 110, 138
BsnI GGCC 1 cut(s) 115
BsoBI CYCGRG 1 cut(s) 155
Bsp1286I GDGCHC 1 cut(s) 162
Bsp143I GATC 1 cut(s) 4
BspANI GGCC 1 cut(s) 115
BspLI GGNNCC 1 cut(s) 6
BspMAI CTGCAG 1 cut(s) 182
BspPI GGATC 1 cut(s) 12
BspTI CTTAAG 1 cut(s) 214
BsrI ACTGG 1 cut(s) 36
BssMI GATC 1 cut(s) 4
BssNAI GTATAC 1 cut(s) 60
Bst1107I GTATAC 1 cut(s) 60
Bst4CI ACNGT 1 cut(s) 68
BstAFI CTTAAG 1 cut(s) 214
BstF5I GGATG 1 cut(s) 249
BstKTI GATC 1 cut(s) 7
BstMBI GATC 1 cut(s) 4
BstSFI CTRYAG 1 cut(s) 178
BstV1I GCAGC 2 cut(s) 164, 192
BstX2I RGATCY 1 cut(s) 4
BstYI RGATCY 1 cut(s) 4
BstZ17I GTATAC 1 cut(s) 60
BsuRI GGCC 1 cut(s) 115
BtrI CACGTC 1 cut(s) 230
BtsCI GGATG 1 cut(s) 249
CviJI RGCY 5 cut(s) 46, 115, 177, 183, 213
CviKI_1 RGCY 5 cut(s) 46, 115, 177, 183, 213
DpnI GATC 1 cut(s) 6
DpnII GATC 1 cut(s) 4
Eco88I CYCGRG 1 cut(s) 155
FaiI YATR 6 cut(s) 56, 60, 129, 150, 186, 196
FblI GTMKAC 1 cut(s) 59
Fnu4HI GCNGC 2 cut(s) 178, 181
FokI GGATG 1 cut(s) 256
Fsp4HI GCNGC 2 cut(s) 178, 181
GluI GCNGC 2 cut(s) 178, 181
HaeIII GGCC 1 cut(s) 115
HinfI GANTC 1 cut(s) 247
HphI GGTGA 1 cut(s) 41
Hpy166II GTNNAC 1 cut(s) 60
Hpy188I TCNGA 2 cut(s) 243, 252
Hpy188III TCNNGA 1 cut(s) 8
Hpy8I GTNNAC 1 cut(s) 60
Hpy99I CGWCG 1 cut(s) 231
HpyAV CCTTC 1 cut(s) 213
HpyCH4III ACNGT 1 cut(s) 68
HpyCH4IV ACGT 1 cut(s) 229
HpyCH4V TGCA 2 cut(s) 108, 180
HpySE526I ACGT 1 cut(s) 229
Kzo9I GATC 1 cut(s) 4
LpnPI CCDG 3 cut(s) 21, 49, 194
Lsp1109I GCAGC 2 cut(s) 164, 192
MaeII ACGT 1 cut(s) 229
MaeIII GTNAC 2 cut(s) 29, 121
MalI GATC 1 cut(s) 6
MboI GATC 1 cut(s) 4
MflI RGATCY 1 cut(s) 4
MhlI GDGCHC 1 cut(s) 162
MnlI CCTC 1 cut(s) 20
MseI TTAA 2 cut(s) 204, 215
MspCI CTTAAG 1 cut(s) 214
Mva1269I GAATGC 2 cut(s) 110, 138
NdeII GATC 1 cut(s) 4
NlaIV GGNNCC 1 cut(s) 6
NmuCI GTSAC 1 cut(s) 29
PaeR7I CTCGAG 1 cut(s) 155
PctI GAATGC 2 cut(s) 110, 138
PfeI GAWTC 1 cut(s) 247
PkrI GCNGC 2 cut(s) 179, 182
PspN4I GGNNCC 1 cut(s) 6
PspXI VCTCGAGB 1 cut(s) 155
PstI CTGCAG 1 cut(s) 182
PsuI RGATCY 1 cut(s) 4
SaqAI TTAA 2 cut(s) 204, 215
SatI GCNGC 2 cut(s) 178, 181
Sau3AI GATC 1 cut(s) 4
SduI GDGCHC 1 cut(s) 162
SetI ASST 5 cut(s) 31, 48, 185, 224, 232
SfcI CTRYAG 1 cut(s) 178
Sfr274I CTCGAG 1 cut(s) 155
SgeI CNNG 8 cut(s) 20, 48, 89, 167, 169, 221, 242, 268
SlaI CTCGAG 1 cut(s) 155
SmlI CTYRAG 2 cut(s) 155, 214
SmoI CTYRAG 2 cut(s) 155, 214
TaaI ACNGT 1 cut(s) 68
TaiI ACGT 1 cut(s) 232
TaqI TCGA 1 cut(s) 156
TfiI GAWTC 1 cut(s) 247
Tru1I TTAA 2 cut(s) 204, 215
Tru9I TTAA 2 cut(s) 204, 215
TseFI GTSAC 1 cut(s) 29
TseI GCWGC 2 cut(s) 177, 180
Tsp45I GTSAC 1 cut(s) 29
Vha464I CTTAAG 1 cut(s) 214
XhoI CTCGAG 1 cut(s) 155
XmiI GTMKAC 1 cut(s) 59
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.