Rh2DG650700

Protein kinase domain

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Forward (+)
87667662 .. 87668372
711 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG650700.1

Sequence Viewer

Length: 216 bp
ATGGTTCAAGTAGCACGATCACCACAAAATAAGGTGGAAAGTAGGCTGGGCAGTGGTGGCTTTGGTCTGGCGTTTGTTGGTCGCCGCATTACAGGTGGAGTAGATCGAACAAGTGGTCCTGATGCTGTTGAGTTAGCACATAAACTCGAGCACAGAAATAGTAAAGGCTGCAGCTATGGTTATCCATATTATCTTAAACAGGGCTTAAGAAGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

71

Amino Acids

7.78

Weight (kDa)

10.21

Isoelectric Point (pI)

50.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021559)

Species Orthologous Gene IDs
rosa_laevigata RLG00000022022
rosa_samantha Rh2AG629300 Rh2CG608400 Rh2DG650700 Rh2DG656400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 85
AflII CTTAAG 1 cut(s) 205
AgsI TTSAA 1 cut(s) 8
AloI GAACNNNNNNTCC 2 cut(s) 100, 132
AluBI AGCT 1 cut(s) 174
AluI AGCT 1 cut(s) 174
Alw21I GWGCWC 1 cut(s) 153
Ama87I CYCGRG 1 cut(s) 146
ApeKI GCWGC 2 cut(s) 168, 171
ArsI GACNNNNNNTTYG 2 cut(s) 100, 132
AspS9I GGNCC 1 cut(s) 116
AsuHPI GGTGA 1 cut(s) 12
AvaI CYCGRG 1 cut(s) 146
AvaII GGWCC 1 cut(s) 116
Bbv12I GWGCWC 1 cut(s) 153
BbvI GCAGC 2 cut(s) 155, 183
BfmI CTRYAG 1 cut(s) 169
BfrI CTTAAG 1 cut(s) 205
BisI GCNGC 3 cut(s) 85, 169, 172
BlsI GCNGC 3 cut(s) 86, 170, 173
Bme18I GGWCC 1 cut(s) 116
BmeT110I CYCGRG 1 cut(s) 146
BmgT120I GGNCC 1 cut(s) 116
BmsI GCATC 1 cut(s) 112
BseXI GCAGC 2 cut(s) 155, 183
BseYI CCCAGC 1 cut(s) 46
BsiHKAI GWGCWC 1 cut(s) 153
BsiHKCI CYCGRG 1 cut(s) 146
BsoBI CYCGRG 1 cut(s) 146
Bsp1286I GDGCHC 1 cut(s) 153
Bsp143I GATC 2 cut(s) 17, 103
BspACI CCGC 1 cut(s) 85
BspMAI CTGCAG 1 cut(s) 173
BspTI CTTAAG 1 cut(s) 205
BssMI GATC 2 cut(s) 17, 103
BstAFI CTTAAG 1 cut(s) 205
BstKTI GATC 2 cut(s) 20, 106
BstMBI GATC 2 cut(s) 17, 103
BstMWI GCNNNNNNNGC 1 cut(s) 57
BstSFI CTRYAG 1 cut(s) 169
BstV1I GCAGC 2 cut(s) 155, 183
BtsI GCAGTG 1 cut(s) 58
BtsIMutI CAGTG 1 cut(s) 58
Cfr13I GGNCC 1 cut(s) 116
CviJI RGCY 5 cut(s) 46, 60, 168, 174, 204
CviKI_1 RGCY 5 cut(s) 46, 60, 168, 174, 204
DpnI GATC 2 cut(s) 19, 105
DpnII GATC 2 cut(s) 17, 103
Eco47I GGWCC 1 cut(s) 116
Eco88I CYCGRG 1 cut(s) 146
FaiI YATR 3 cut(s) 141, 177, 187
Fnu4HI GCNGC 3 cut(s) 85, 169, 172
Fsp4HI GCNGC 3 cut(s) 85, 169, 172
GluI GCNGC 3 cut(s) 85, 169, 172
GsaI CCCAGC 1 cut(s) 50
HphI GGTGA 1 cut(s) 12
Hpy188III TCNNGA 1 cut(s) 119
HpyAV CCTTC 1 cut(s) 204
HpyCH4V TGCA 1 cut(s) 171
HpyF10VI GCNNNNNNNGC 1 cut(s) 57
Kzo9I GATC 2 cut(s) 17, 103
LpnPI CCDG 5 cut(s) 32, 53, 78, 132, 185
Lsp1109I GCAGC 2 cut(s) 155, 183
LweI GCATC 1 cut(s) 112
MalI GATC 2 cut(s) 19, 105
MboI GATC 2 cut(s) 17, 103
MhlI GDGCHC 1 cut(s) 153
MseI TTAA 2 cut(s) 195, 206
MspCI CTTAAG 1 cut(s) 205
MwoI GCNNNNNNNGC 1 cut(s) 57
NdeII GATC 2 cut(s) 17, 103
PaeR7I CTCGAG 1 cut(s) 146
PkrI GCNGC 3 cut(s) 86, 170, 173
PspFI CCCAGC 1 cut(s) 46
PspPI GGNCC 1 cut(s) 116
PspXI VCTCGAGB 1 cut(s) 146
PstI CTGCAG 1 cut(s) 173
SaqAI TTAA 2 cut(s) 195, 206
SatI GCNGC 3 cut(s) 85, 169, 172
Sau3AI GATC 2 cut(s) 17, 103
Sau96I GGNCC 1 cut(s) 116
SduI GDGCHC 1 cut(s) 153
SetI ASST 4 cut(s) 36, 97, 176, 215
SfaNI GCATC 1 cut(s) 112
SfcI CTRYAG 1 cut(s) 169
Sfr274I CTCGAG 1 cut(s) 146
SinI GGWCC 1 cut(s) 116
SlaI CTCGAG 1 cut(s) 146
SmlI CTYRAG 2 cut(s) 146, 205
SmoI CTYRAG 2 cut(s) 146, 205
SsiI CCGC 1 cut(s) 85
TaqI TCGA 2 cut(s) 106, 147
TauI GCSGC 1 cut(s) 87
Tru1I TTAA 2 cut(s) 195, 206
Tru9I TTAA 2 cut(s) 195, 206
TscAI CASTG 1 cut(s) 58
TseI GCWGC 2 cut(s) 168, 171
TspRI CASTG 1 cut(s) 58
Vha464I CTTAAG 1 cut(s) 205
VpaK11BI GGWCC 1 cut(s) 116
XhoI CTCGAG 1 cut(s) 146
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.