Rh2DG015200

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Reverse (-)
877561 .. 877860
300 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG015200.1

Sequence Viewer

Length: 300 bp
ATGACACCATCAGATTATTCTATTGAGTGCCAGACAAGGACTCATTCTGCAGGTTTGAAGTGGACAGGGCGGAAAGCTGTCTTGGCAGTGTTGAAAATACCAACCAATGTGTTTCCCTCTTCCCCATCACCTTGCATGACAAGAAAATTTGAAGAGGAAAACGACAACATAAAGCCTCAAATCCCAGCAGTTATCAACGGAGTGTCACAAGTCAATGGTGAATGTAAAAGAACTAGACTATTGCTAGGCACATCGGTCTCGATGAAGATTGATGAGCATACAACTTGTGTTCGAGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

99

Amino Acids

10.95

Weight (kDa)

9.07

Isoelectric Point (pI)

45.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0025518)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0001748.1_g000011
rosa_samantha Rh2AG012900 Rh2DG015200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 41
AciI CCGC 1 cut(s) 70
AcsI RAATTY 1 cut(s) 146
AgsI TTSAA 3 cut(s) 58, 94, 152
AjuI GAANNNNNNNTTGG 2 cut(s) 65, 97
AluBI AGCT 1 cut(s) 77
AluI AGCT 1 cut(s) 77
Alw26I GTCTC 1 cut(s) 262
ApoI RAATTY 1 cut(s) 146
AsuHPI GGTGA 2 cut(s) 120, 230
BccI CCATC 2 cut(s) 16, 133
BcoDI GTCTC 1 cut(s) 262
BfaI CTAG 2 cut(s) 234, 245
BfmI CTRYAG 1 cut(s) 48
BfuAI ACCTGC 1 cut(s) 41
BsaI GGTCTC 1 cut(s) 262
BseYI CCCAGC 1 cut(s) 184
BsmAI GTCTC 1 cut(s) 262
Bso31I GGTCTC 1 cut(s) 262
BspACI CCGC 1 cut(s) 70
BspMAI CTGCAG 1 cut(s) 52
BspMI ACCTGC 1 cut(s) 41
BspTNI GGTCTC 1 cut(s) 262
Bst6I CTCTTC 2 cut(s) 124, 147
BstMAI GTCTC 1 cut(s) 262
BstMWI GCNNNNNNNGC 1 cut(s) 83
BstSFI CTRYAG 1 cut(s) 48
BtsI GCAGTG 1 cut(s) 93
BtsIMutI CAGTG 1 cut(s) 93
BveI ACCTGC 1 cut(s) 41
CviAII CATG 1 cut(s) 136
CviJI RGCY 2 cut(s) 77, 175
CviKI_1 RGCY 2 cut(s) 77, 175
Eam1104I CTCTTC 2 cut(s) 124, 147
EarI CTCTTC 2 cut(s) 124, 147
EciI GGCGGA 1 cut(s) 85
Eco31I GGTCTC 1 cut(s) 262
FaeI CATG 1 cut(s) 139
FaiI YATR 3 cut(s) 137, 170, 279
FatI CATG 1 cut(s) 135
FspBI CTAG 2 cut(s) 234, 245
GsaI CCCAGC 1 cut(s) 188
Hin1II CATG 1 cut(s) 139
HinfI GANTC 1 cut(s) 40
HphI GGTGA 2 cut(s) 120, 230
Hpy166II GTNNAC 1 cut(s) 63
Hpy188I TCNGA 1 cut(s) 13
Hpy188III TCNNGA 1 cut(s) 259
Hpy8I GTNNAC 1 cut(s) 63
HpyCH4V TGCA 2 cut(s) 50, 135
HpyF10VI GCNNNNNNNGC 1 cut(s) 83
Hsp92II CATG 1 cut(s) 139
LpnPI CCDG 4 cut(s) 36, 44, 51, 198
MaeI CTAG 2 cut(s) 234, 245
MaeIII GTNAC 1 cut(s) 204
MboII GAAGA 3 cut(s) 111, 164, 277
MluCI AATT 1 cut(s) 146
MlyI GAGTC 1 cut(s) 34
MnlI CCTC 3 cut(s) 127, 148, 186
MwoI GCNNNNNNNGC 1 cut(s) 83
NlaIII CATG 1 cut(s) 139
NmuCI GTSAC 1 cut(s) 204
PleI GAGTC 1 cut(s) 34
PpsI GAGTC 1 cut(s) 34
PspFI CCCAGC 1 cut(s) 184
PstI CTGCAG 1 cut(s) 52
SchI GAGTC 1 cut(s) 34
SetI ASST 3 cut(s) 55, 79, 133
SfcI CTRYAG 1 cut(s) 48
Sse9I AATT 1 cut(s) 146
SsiI CCGC 1 cut(s) 70
SspMI CTAG 2 cut(s) 234, 245
TaqI TCGA 2 cut(s) 260, 292
TaqII GACCGA 1 cut(s) 244
TasI AATT 1 cut(s) 146
TscAI CASTG 1 cut(s) 93
TseFI GTSAC 1 cut(s) 204
Tsp45I GTSAC 1 cut(s) 204
TspDTI ATGAA 1 cut(s) 278
TspGWI ACGGA 1 cut(s) 213
TspRI CASTG 1 cut(s) 93
XapI RAATTY 1 cut(s) 146
XspI CTAG 2 cut(s) 234, 245
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.