Rh2DG119000

G-quadruplex DNA unwinding

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Reverse (-)
9912365 .. 9913520
1156 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG119000.1

Sequence Viewer

Length: 589 bp
ATGATCTATATCCTGGAATCCAGGACCTGGATTCTATGTATTCCCAAAAAATCAGTGTTTGTTTTCTTCACAACTTATGCAGCGATGGCATCAAGACCTAGAAAAGTCAAGGGAAGAAGTGATGAAATTAAGTCAAGAAGGTGGAAACAAGTATCTCAGCCGATAGTGGCAACAGATAATGAAGCTCTGGAGATGACGAATGAAGATATGAGCATATTGGAACATCGAGATAAACGGATTAGAACCAATCGACAAATTCCTGCTGTTATTGTGAATCAACCTCTCTCTCTTGATGAACATTCAAGTAACAATAATACAGTTGTACCTGAACATGTGGTGAATAGTAATTCCTTGCAATTTGCAGAAAGTGCTGACATCATAGGTGAATGTTCTCAGTCTTTTGGTCAAGCATTATATCAAAGAACTAAACAAGGATCAGTTGTTACATATGAAGATTCAGGCGATAATGTTTACACATGTAAGTATTGTAATGCATGTTTTTGGGTTGAAGAAGCTATCAAACAAAAATCTAGAAAAGCATTGCCCATTTATACAAATTGTTGTCAAAAAGGAGAAATCAAGCTTCCAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

196

Amino Acids

22.4

Weight (kDa)

8.64

Isoelectric Point (pI)

47.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0034324)

Species Orthologous Gene IDs
rosa_samantha Rh2DG119000 Rh5DG134300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 27
AclWI GGATC 1 cut(s) 442
AcsI RAATTY 1 cut(s) 255
AfaI GTAC 1 cut(s) 324
AfiI CCNNNNNNNGG 1 cut(s) 27
AflIII ACRYGT 2 cut(s) 331, 476
AgsI TTSAA 2 cut(s) 303, 509
AjnI CCWGG 3 cut(s) 12, 20, 26
AluBI AGCT 3 cut(s) 185, 515, 583
AluI AGCT 3 cut(s) 185, 515, 583
AlwI GGATC 1 cut(s) 442
AlwNI CAGNNNCTG 1 cut(s) 27
ApeKI GCWGC 1 cut(s) 80
ApoI RAATTY 1 cut(s) 255
AspS9I GGNCC 1 cut(s) 24
AsuHPI GGTGA 2 cut(s) 349, 395
AvaII GGWCC 1 cut(s) 24
BaeI ACNNNNGTAYC 2 cut(s) 306, 339
BbvI GCAGC 1 cut(s) 92
BccI CCATC 1 cut(s) 79
BciT130I CCWGG 3 cut(s) 14, 22, 28
BfaI CTAG 2 cut(s) 99, 531
BisI GCNGC 1 cut(s) 81
BlsI GCNGC 1 cut(s) 82
Bme1390I CCNGG 3 cut(s) 14, 22, 28
Bme18I GGWCC 1 cut(s) 24
BmgT120I GGNCC 1 cut(s) 24
BmrFI CCNGG 3 cut(s) 14, 22, 28
BmsI GCATC 1 cut(s) 98
BpmI CTGGAG 1 cut(s) 209
BsaBI GATNNNNATC 1 cut(s) 8
Bsc4I CCNNNNNNNGG 1 cut(s) 27
Bse3DI GCAATG 1 cut(s) 539
Bse8I GATNNNNATC 1 cut(s) 8
BseBI CCWGG 3 cut(s) 14, 22, 28
BseJI GATNNNNATC 1 cut(s) 8
BseLI CCNNNNNNNGG 1 cut(s) 27
BseMI GCAATG 1 cut(s) 539
BseMII CTCAG 2 cut(s) 170, 407
BseXI GCAGC 1 cut(s) 92
BslI CCNNNNNNNGG 1 cut(s) 27
Bsp143I GATC 2 cut(s) 3, 434
BspCNI CTCAG 2 cut(s) 169, 406
BspPI GGATC 1 cut(s) 442
BsrDI GCAATG 1 cut(s) 539
BssMI GATC 2 cut(s) 3, 434
Bst2UI CCWGG 3 cut(s) 14, 22, 28
Bst4CI ACNGT 1 cut(s) 319
BstAPI GCANNNNNTGC 1 cut(s) 368
BstDEI CTNAG 2 cut(s) 156, 393
BstKTI GATC 2 cut(s) 6, 437
BstMBI GATC 2 cut(s) 3, 434
BstMWI GCNNNNNNNGC 2 cut(s) 86, 368
BstNI CCWGG 3 cut(s) 14, 22, 28
BstNSI RCATGY 3 cut(s) 335, 480, 498
BstSCI CCNGG 3 cut(s) 12, 20, 26
BstV1I GCAGC 1 cut(s) 92
BtgZI GCGATG 1 cut(s) 98
BtsIMutI CAGTG 1 cut(s) 60
CaiI CAGNNNCTG 1 cut(s) 27
Cfr13I GGNCC 1 cut(s) 24
Csp6I GTAC 1 cut(s) 323
CviAII CATG 3 cut(s) 332, 477, 495
CviJI RGCY 4 cut(s) 160, 185, 515, 583
CviKI_1 RGCY 4 cut(s) 160, 185, 515, 583
CviQI GTAC 1 cut(s) 323
DdeI CTNAG 2 cut(s) 156, 393
DpnI GATC 2 cut(s) 5, 436
DpnII GATC 2 cut(s) 3, 434
Eco47I GGWCC 1 cut(s) 24
EcoO109I RGGNCCY 1 cut(s) 24
EcoRII CCWGG 3 cut(s) 12, 20, 26
EcoT22I ATGCAT 1 cut(s) 496
FaeI CATG 3 cut(s) 335, 480, 498
FatI CATG 3 cut(s) 331, 476, 494
FauNDI CATATG 1 cut(s) 448
Fnu4HI GCNGC 1 cut(s) 81
Fsp4HI GCNGC 1 cut(s) 81
FspBI CTAG 2 cut(s) 99, 531
GluI GCNGC 1 cut(s) 81
GsuI CTGGAG 1 cut(s) 209
Hin1II CATG 3 cut(s) 335, 480, 498
HindIII AAGCTT 1 cut(s) 581
HinfI GANTC 4 cut(s) 17, 31, 274, 455
HphI GGTGA 2 cut(s) 349, 395
Hpy166II GTNNAC 1 cut(s) 472
Hpy188III TCNNGA 6 cut(s) 93, 135, 188, 227, 290, 531
Hpy8I GTNNAC 1 cut(s) 472
HpyAV CCTTC 1 cut(s) 132
HpyCH4III ACNGT 1 cut(s) 319
HpyCH4V TGCA 4 cut(s) 80, 355, 362, 494
HpyF10VI GCNNNNNNNGC 2 cut(s) 86, 368
HpyF3I CTNAG 2 cut(s) 156, 393
Hsp92II CATG 3 cut(s) 335, 480, 498
Kzo9I GATC 2 cut(s) 3, 434
LpnPI CCDG 9 cut(s) 7, 13, 26, 34, 40, 173, 273, 339, 444
Lsp1109I GCAGC 1 cut(s) 92
LweI GCATC 1 cut(s) 98
MaeI CTAG 2 cut(s) 99, 531
MaeIII GTNAC 2 cut(s) 305, 442
MalI GATC 2 cut(s) 5, 436
MboI GATC 2 cut(s) 3, 434
MboII GAAGA 5 cut(s) 58, 126, 215, 464, 521
MluCI AATT 5 cut(s) 126, 255, 346, 356, 556
MnlI CCTC 1 cut(s) 291
Mph1103I ATGCAT 1 cut(s) 496
MseI TTAA 1 cut(s) 129
MspR9I CCNGG 3 cut(s) 14, 22, 28
MvaI CCWGG 3 cut(s) 14, 22, 28
MwoI GCNNNNNNNGC 2 cut(s) 86, 368
NdeI CATATG 1 cut(s) 448
NdeII GATC 2 cut(s) 3, 434
NlaIII CATG 3 cut(s) 335, 480, 498
NsiI ATGCAT 1 cut(s) 496
NspI RCATGY 3 cut(s) 335, 480, 498
PciI ACATGT 2 cut(s) 331, 476
PfeI GAWTC 4 cut(s) 17, 31, 274, 455
PflMI CCANNNNNTGG 1 cut(s) 27
PfoI TCCNGGA 2 cut(s) 12, 20
PkrI GCNGC 1 cut(s) 82
PpuMI RGGWCCY 1 cut(s) 24
PscI ACATGT 2 cut(s) 331, 476
Psp5II RGGWCCY 1 cut(s) 24
Psp6I CCWGG 3 cut(s) 12, 20, 26
PspGI CCWGG 3 cut(s) 12, 20, 26
PspPI GGNCC 1 cut(s) 24
PspPPI RGGWCCY 1 cut(s) 24
PstNI CAGNNNCTG 1 cut(s) 27
RsaI GTAC 1 cut(s) 324
RsaNI GTAC 1 cut(s) 323
SaqAI TTAA 1 cut(s) 129
SatI GCNGC 1 cut(s) 81
Sau3AI GATC 2 cut(s) 3, 434
Sau96I GGNCC 1 cut(s) 24
ScrFI CCNGG 3 cut(s) 14, 22, 28
SetI ASST 9 cut(s) 29, 100, 143, 187, 283, 328, 385, 517, 585
SfaNI GCATC 1 cut(s) 98
SinI GGWCC 1 cut(s) 24
Sse9I AATT 5 cut(s) 126, 255, 346, 356, 556
SspMI CTAG 2 cut(s) 99, 531
StyD4I CCNGG 3 cut(s) 12, 20, 26
TaaI ACNGT 1 cut(s) 319
TaqI TCGA 2 cut(s) 226, 250
TasI AATT 5 cut(s) 126, 255, 346, 356, 556
TfiI GAWTC 4 cut(s) 17, 31, 274, 455
Tru1I TTAA 1 cut(s) 129
Tru9I TTAA 1 cut(s) 129
TscAI CASTG 1 cut(s) 60
TseI GCWGC 1 cut(s) 80
TspDTI ATGAA 5 cut(s) 138, 195, 216, 309, 465
TspGWI ACGGA 1 cut(s) 250
TspRI CASTG 1 cut(s) 60
Van91I CCANNNNNTGG 1 cut(s) 27
VpaK11BI GGWCC 1 cut(s) 24
XapI RAATTY 1 cut(s) 255
XbaI TCTAGA 1 cut(s) 530
XceI RCATGY 3 cut(s) 335, 480, 498
XspI CTAG 2 cut(s) 99, 531
Zsp2I ATGCAT 1 cut(s) 496
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.