Rh5DG134300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Forward (+)
13315168 .. 13322530
7363 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG134300.1

Sequence Viewer

Length: 495 bp
ATGATCTATATCCTGGAATCCAGGACCTGGATTCTTTGTATTCCCAAAAAATCAGTGTTTGTTTTCTTCACAACTTATGCAGCGATGGCATCAAGACCTAGAAAAGTCAAGGGAAGAAGTGATGAAATTAAGTCAAGAAGGTGGAAACAAGTATCTCAGCCGATAGTGGCAACAGATAATGAAGCTCTGGAGATGACGAATGAAGATATGAGCATATTGGAACATCGAGATAAACGGATTAGAACCAATCGACAAATTCCTACTGTTACTGTGAATCAACCTCCCTCTCTTCATGAACATTCAAGTAACAATAATACAGTTGTACCTGAACATGTGGTGAATAGTAATTCCTTGCAATTTGCAGAGAGTGCTGACATCAGAGTTGTACCTGAACATGTGGTGAATAGTAATTCCTTGCAATTTGCAGAGAGTGCTGACATCAGAGGTTCTGCCATTGGTATTGGATTTGGGACTTTGGGATTGAACCTGCTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

164

Amino Acids

18.46

Weight (kDa)

8.85

Isoelectric Point (pI)

44.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0034324)

Species Orthologous Gene IDs
rosa_samantha Rh2DG119000 Rh5DG134300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 27
AcsI RAATTY 1 cut(s) 255
AfaI GTAC 2 cut(s) 324, 387
AfiI CCNNNNNNNGG 1 cut(s) 27
AflIII ACRYGT 2 cut(s) 331, 394
AgsI TTSAA 2 cut(s) 303, 484
AjnI CCWGG 3 cut(s) 12, 20, 26
AluBI AGCT 1 cut(s) 185
AluI AGCT 1 cut(s) 185
AlwNI CAGNNNCTG 1 cut(s) 27
ApeKI GCWGC 1 cut(s) 80
ApoI RAATTY 1 cut(s) 255
AspS9I GGNCC 1 cut(s) 24
AsuHPI GGTGA 2 cut(s) 349, 412
AvaII GGWCC 1 cut(s) 24
BaeI ACNNNNGTAYC 2 cut(s) 306, 339
BbvI GCAGC 1 cut(s) 92
BccI CCATC 1 cut(s) 79
BciT130I CCWGG 3 cut(s) 14, 22, 28
BfaI CTAG 1 cut(s) 99
BisI GCNGC 1 cut(s) 81
BlsI GCNGC 1 cut(s) 82
Bme1390I CCNGG 3 cut(s) 14, 22, 28
Bme18I GGWCC 1 cut(s) 24
BmgT120I GGNCC 1 cut(s) 24
BmrFI CCNGG 3 cut(s) 14, 22, 28
BmsI GCATC 1 cut(s) 98
BpmI CTGGAG 1 cut(s) 209
BsaBI GATNNNNATC 1 cut(s) 8
Bsc4I CCNNNNNNNGG 1 cut(s) 27
Bse8I GATNNNNATC 1 cut(s) 8
BseBI CCWGG 3 cut(s) 14, 22, 28
BseJI GATNNNNATC 1 cut(s) 8
BseLI CCNNNNNNNGG 1 cut(s) 27
BseMII CTCAG 1 cut(s) 170
BseXI GCAGC 1 cut(s) 92
BslFI GGGAC 1 cut(s) 484
BslI CCNNNNNNNGG 1 cut(s) 27
BsmFI GGGAC 1 cut(s) 484
Bsp143I GATC 1 cut(s) 3
BspCNI CTCAG 1 cut(s) 169
BspHI TCATGA 1 cut(s) 292
BssMI GATC 1 cut(s) 3
Bst2UI CCWGG 3 cut(s) 14, 22, 28
Bst4CI ACNGT 3 cut(s) 265, 271, 319
Bst6I CTCTTC 1 cut(s) 294
BstAPI GCANNNNNTGC 2 cut(s) 368, 431
BstDEI CTNAG 1 cut(s) 156
BstKTI GATC 1 cut(s) 6
BstMBI GATC 1 cut(s) 3
BstMWI GCNNNNNNNGC 3 cut(s) 86, 368, 431
BstNI CCWGG 3 cut(s) 14, 22, 28
BstNSI RCATGY 2 cut(s) 335, 398
BstSCI CCNGG 3 cut(s) 12, 20, 26
BstV1I GCAGC 1 cut(s) 92
BtgZI GCGATG 1 cut(s) 98
BtsIMutI CAGTG 1 cut(s) 60
CaiI CAGNNNCTG 1 cut(s) 27
CciI TCATGA 1 cut(s) 292
Cfr13I GGNCC 1 cut(s) 24
Csp6I GTAC 2 cut(s) 323, 386
CviAII CATG 3 cut(s) 293, 332, 395
CviJI RGCY 2 cut(s) 160, 185
CviKI_1 RGCY 2 cut(s) 160, 185
CviQI GTAC 2 cut(s) 323, 386
DdeI CTNAG 1 cut(s) 156
DpnI GATC 1 cut(s) 5
DpnII GATC 1 cut(s) 3
Eam1104I CTCTTC 1 cut(s) 294
EarI CTCTTC 1 cut(s) 294
Eco47I GGWCC 1 cut(s) 24
EcoO109I RGGNCCY 1 cut(s) 24
EcoRII CCWGG 3 cut(s) 12, 20, 26
FaeI CATG 3 cut(s) 296, 335, 398
FaiI YATR 7 cut(s) 9, 78, 209, 215, 294, 333, 396
FaqI GGGAC 1 cut(s) 484
FatI CATG 3 cut(s) 292, 331, 394
Fnu4HI GCNGC 1 cut(s) 81
Fsp4HI GCNGC 1 cut(s) 81
FspBI CTAG 1 cut(s) 99
GluI GCNGC 1 cut(s) 81
GsuI CTGGAG 1 cut(s) 209
Hin1II CATG 3 cut(s) 296, 335, 398
HinfI GANTC 3 cut(s) 17, 31, 274
HphI GGTGA 2 cut(s) 349, 412
Hpy188I TCNGA 2 cut(s) 380, 443
Hpy188III TCNNGA 5 cut(s) 93, 135, 188, 227, 293
HpyAV CCTTC 1 cut(s) 132
HpyCH4III ACNGT 3 cut(s) 265, 271, 319
HpyCH4V TGCA 5 cut(s) 80, 355, 362, 418, 425
HpyF10VI GCNNNNNNNGC 3 cut(s) 86, 368, 431
HpyF3I CTNAG 1 cut(s) 156
Hsp92II CATG 3 cut(s) 296, 335, 398
Kzo9I GATC 1 cut(s) 3
LpnPI CCDG 8 cut(s) 7, 13, 26, 34, 40, 173, 339, 402
Lsp1109I GCAGC 1 cut(s) 92
LweI GCATC 1 cut(s) 98
MaeI CTAG 1 cut(s) 99
MaeIII GTNAC 2 cut(s) 265, 305
MalI GATC 1 cut(s) 5
MboI GATC 1 cut(s) 3
MboII GAAGA 4 cut(s) 58, 126, 215, 281
MluCI AATT 6 cut(s) 126, 255, 346, 356, 409, 419
MnlI CCTC 3 cut(s) 291, 295, 437
MseI TTAA 1 cut(s) 129
MspR9I CCNGG 3 cut(s) 14, 22, 28
MvaI CCWGG 3 cut(s) 14, 22, 28
MwoI GCNNNNNNNGC 3 cut(s) 86, 368, 431
NdeII GATC 1 cut(s) 3
NlaIII CATG 3 cut(s) 296, 335, 398
NspI RCATGY 2 cut(s) 335, 398
PagI TCATGA 1 cut(s) 292
PciI ACATGT 2 cut(s) 331, 394
PfeI GAWTC 3 cut(s) 17, 31, 274
PflMI CCANNNNNTGG 1 cut(s) 27
PfoI TCCNGGA 2 cut(s) 12, 20
PkrI GCNGC 1 cut(s) 82
PpuMI RGGWCCY 1 cut(s) 24
PscI ACATGT 2 cut(s) 331, 394
Psp5II RGGWCCY 1 cut(s) 24
Psp6I CCWGG 3 cut(s) 12, 20, 26
PspGI CCWGG 3 cut(s) 12, 20, 26
PspPI GGNCC 1 cut(s) 24
PspPPI RGGWCCY 1 cut(s) 24
PstNI CAGNNNCTG 1 cut(s) 27
RsaI GTAC 2 cut(s) 324, 387
RsaNI GTAC 2 cut(s) 323, 386
SaqAI TTAA 1 cut(s) 129
SatI GCNGC 1 cut(s) 81
Sau3AI GATC 1 cut(s) 3
Sau96I GGNCC 1 cut(s) 24
ScrFI CCNGG 3 cut(s) 14, 22, 28
SetI ASST 9 cut(s) 29, 100, 143, 187, 283, 328, 391, 448, 489
SfaNI GCATC 1 cut(s) 98
SinI GGWCC 1 cut(s) 24
Sse9I AATT 6 cut(s) 126, 255, 346, 356, 409, 419
SspMI CTAG 1 cut(s) 99
StyD4I CCNGG 3 cut(s) 12, 20, 26
TaaI ACNGT 3 cut(s) 265, 271, 319
TaqI TCGA 2 cut(s) 226, 250
TasI AATT 6 cut(s) 126, 255, 346, 356, 409, 419
TfiI GAWTC 3 cut(s) 17, 31, 274
Tru1I TTAA 1 cut(s) 129
Tru9I TTAA 1 cut(s) 129
TscAI CASTG 1 cut(s) 60
TseI GCWGC 1 cut(s) 80
TspDTI ATGAA 5 cut(s) 138, 195, 216, 281, 309
TspGWI ACGGA 1 cut(s) 250
TspRI CASTG 1 cut(s) 60
Van91I CCANNNNNTGG 1 cut(s) 27
VpaK11BI GGWCC 1 cut(s) 24
XapI RAATTY 1 cut(s) 255
XceI RCATGY 2 cut(s) 335, 398
XspI CTAG 1 cut(s) 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.