Rh2DG164400
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Forward (+)
14291833 .. 14292042
210 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG164400.1

Sequence Viewer

Length: 210 bp
ATGGATGCCAAGATAAATGGCCAATATTCCTCCAAGGAAGCATTACAGACAGCAAAGGTTACCCTAAAATGCCTAGCATCAGATCCTAAAGGTCGTCCTTCGATGAAAGAAGTTGTGGATGCATTGGAGCAGATTCAGGCAATCAAGGAAAACTCAAAACAAACAGAACTTACCCCAACTACAAAATCTACTCCAAGTTCTCAATCCTGA

Protein Analysis

69

Amino Acids

7.47

Weight (kDa)

8.82

Isoelectric Point (pI)

36.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0033830)

Species Orthologous Gene IDs
rosa_samantha Rh2AG159100 Rh2DG164400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 77
AcoI YGGCCR 1 cut(s) 19
AlwI GGATC 1 cut(s) 77
AoxI GGCC 1 cut(s) 19
BalI TGGCCA 1 cut(s) 21
BfaI CTAG 1 cut(s) 74
BmsI GCATC 2 cut(s) 86, 109
BsaJI CCNNGG 1 cut(s) 33
BseDI CCNNGG 1 cut(s) 33
BseGI GGATG 2 cut(s) 10, 124
BshFI GGCC 1 cut(s) 21
BsnI GGCC 1 cut(s) 21
Bsp143I GATC 1 cut(s) 82
BspANI GGCC 1 cut(s) 21
BspPI GGATC 1 cut(s) 77
BssECI CCNNGG 1 cut(s) 33
BssMI GATC 1 cut(s) 82
BssT1I CCWWGG 1 cut(s) 33
BstEII GGTNACC 1 cut(s) 58
BstF5I GGATG 2 cut(s) 10, 124
BstKTI GATC 1 cut(s) 85
BstMBI GATC 1 cut(s) 82
BstPI GGTNACC 1 cut(s) 58
BstX2I RGATCY 1 cut(s) 82
BstYI RGATCY 1 cut(s) 82
BsuRI GGCC 1 cut(s) 21
BtsCI GGATG 2 cut(s) 10, 124
CviJI RGCY 1 cut(s) 21
CviKI_1 RGCY 1 cut(s) 21
DpnI GATC 1 cut(s) 84
DpnII GATC 1 cut(s) 82
EaeI YGGCCR 1 cut(s) 19
Eco130I CCWWGG 1 cut(s) 33
Eco91I GGTNACC 1 cut(s) 58
EcoO65I GGTNACC 1 cut(s) 58
EcoT14I CCWWGG 1 cut(s) 33
EcoT22I ATGCAT 1 cut(s) 124
ErhI CCWWGG 1 cut(s) 33
FokI GGATG 2 cut(s) 17, 131
FspBI CTAG 1 cut(s) 74
HaeIII GGCC 1 cut(s) 21
HinfI GANTC 1 cut(s) 133
Hpy188I TCNGA 1 cut(s) 82
Hpy188III TCNNGA 1 cut(s) 207
HpyAV CCTTC 1 cut(s) 108
HpyCH4V TGCA 1 cut(s) 122
Kzo9I GATC 1 cut(s) 82
LmnI GCTCC 1 cut(s) 127
LpnPI CCDG 1 cut(s) 122
LweI GCATC 2 cut(s) 86, 109
MaeI CTAG 1 cut(s) 74
MaeIII GTNAC 1 cut(s) 58
MalI GATC 1 cut(s) 84
MboI GATC 1 cut(s) 82
MflI RGATCY 1 cut(s) 82
MlsI TGGCCA 1 cut(s) 21
MluNI TGGCCA 1 cut(s) 21
MnlI CCTC 1 cut(s) 40
Mox20I TGGCCA 1 cut(s) 21
Mph1103I ATGCAT 1 cut(s) 124
MscI TGGCCA 1 cut(s) 21
Msp20I TGGCCA 1 cut(s) 21
NdeII GATC 1 cut(s) 82
NsiI ATGCAT 1 cut(s) 124
PfeI GAWTC 1 cut(s) 133
PspEI GGTNACC 1 cut(s) 58
PsuI RGATCY 1 cut(s) 82
Sau3AI GATC 1 cut(s) 82
SetI ASST 2 cut(s) 60, 94
SfaNI GCATC 2 cut(s) 86, 109
SgeI CNNG 5 cut(s) 22, 46, 86, 149, 157
SspI AATATT 1 cut(s) 26
SspMI CTAG 1 cut(s) 74
StyI CCWWGG 1 cut(s) 33
TaqI TCGA 1 cut(s) 101
TfiI GAWTC 1 cut(s) 133
TspDTI ATGAA 1 cut(s) 119
XspI CTAG 1 cut(s) 74
Zsp2I ATGCAT 1 cut(s) 124
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.