Rh3AG122000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
Physical Location & Seq
Forward (+)
10466710 .. 10467331
622 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG122000.1

Sequence Viewer

Length: 249 bp
ATGTCTGGACCATCTGGGCATTTTGCTAGTCCACCACCGGAGGTGGACGAGCAAAATGAAGACCCTCCAGTGGTGGACGTGCCTCTTTTTGACCAGAGGGGTCTGTTGTTGAACTGGAGGAGGCTATTTAAGACCCGGAGCCTATTGAAGACCCGGAGGAGGCTATTGAAGACCCGGACGAGCCTGAGCCAGTTGATGGTCCAAATCTCAATTTCAATGCTCGCGCCTTTCGTTATGATATATTGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

82

Amino Acids

9.43

Weight (kDa)

10.0

Isoelectric Point (pI)

65.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0032187)

Species Orthologous Gene IDs
rosa_roxburghii Rroxscaffold_6G00416570
rosa_samantha Rh3AG122000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 196
AccII CGCG 1 cut(s) 224
AfiI CCNNNNNNNGG 3 cut(s) 70, 159, 196
AgsI TTSAA 4 cut(s) 112, 148, 169, 216
AjiI CACGTC 1 cut(s) 79
AspLEI GCGC 1 cut(s) 226
AspS9I GGNCC 2 cut(s) 8, 199
AsuC2I CCSGG 3 cut(s) 136, 154, 175
AvaII GGWCC 2 cut(s) 8, 199
BbsI GAAGAC 3 cut(s) 66, 155, 176
BccI CCATC 2 cut(s) 19, 190
BcnI CCSGG 3 cut(s) 136, 154, 175
BfaI CTAG 1 cut(s) 27
Bme1390I CCNGG 3 cut(s) 136, 154, 175
Bme18I GGWCC 2 cut(s) 8, 199
BmgBI CACGTC 1 cut(s) 79
BmgT120I GGNCC 2 cut(s) 8, 199
BmiI GGNNCC 1 cut(s) 140
BmrFI CCNGG 3 cut(s) 136, 154, 175
BpiI GAAGAC 3 cut(s) 66, 155, 176
BpmI CTGGAG 2 cut(s) 51, 136
Bpu10I CCTNAGC 1 cut(s) 185
BpuMI CCSGG 3 cut(s) 136, 154, 175
BsaWI WCCGGW 1 cut(s) 37
Bsc4I CCNNNNNNNGG 3 cut(s) 70, 159, 196
Bse1I ACTGG 3 cut(s) 68, 119, 190
BseLI CCNNNNNNNGG 3 cut(s) 70, 159, 196
BseMII CTCAG 1 cut(s) 176
BseNI ACTGG 3 cut(s) 68, 119, 190
BseRI GAGGAG 2 cut(s) 133, 172
Bsh1236I CGCG 1 cut(s) 224
BsiSI CCGG 4 cut(s) 38, 136, 154, 175
BslI CCNNNNNNNGG 3 cut(s) 70, 159, 196
BspCNI CTCAG 1 cut(s) 177
BspFNI CGCG 1 cut(s) 224
BspLI GGNNCC 1 cut(s) 140
BsrI ACTGG 3 cut(s) 68, 119, 190
BstC8I GCNNGC 1 cut(s) 222
BstDEI CTNAG 1 cut(s) 185
BstFNI CGCG 1 cut(s) 224
BstHHI GCGC 1 cut(s) 226
BstSCI CCNGG 3 cut(s) 134, 152, 173
BstUI CGCG 1 cut(s) 224
BstV2I GAAGAC 3 cut(s) 66, 155, 176
BtrI CACGTC 1 cut(s) 79
BtsIMutI CAGTG 1 cut(s) 75
Cac8I GCNNGC 1 cut(s) 222
CfoI GCGC 1 cut(s) 226
Cfr13I GGNCC 2 cut(s) 8, 199
CviJI RGCY 5 cut(s) 124, 141, 163, 183, 189
CviKI_1 RGCY 5 cut(s) 124, 141, 163, 183, 189
DdeI CTNAG 1 cut(s) 185
Eco47I GGWCC 2 cut(s) 8, 199
FaiI YATR 2 cut(s) 236, 241
FspBI CTAG 1 cut(s) 27
GlaI GCGC 1 cut(s) 225
GsuI CTGGAG 2 cut(s) 51, 136
HapII CCGG 4 cut(s) 38, 136, 154, 175
HhaI GCGC 1 cut(s) 226
Hin6I GCGC 1 cut(s) 224
HinP1I GCGC 1 cut(s) 224
HpaII CCGG 4 cut(s) 38, 136, 154, 175
Hpy166II GTNNAC 3 cut(s) 32, 46, 76
Hpy188III TCNNGA 1 cut(s) 6
Hpy8I GTNNAC 3 cut(s) 32, 46, 76
HpyCH4IV ACGT 1 cut(s) 78
HpyF3I CTNAG 1 cut(s) 185
HpySE526I ACGT 1 cut(s) 78
HspAI GCGC 1 cut(s) 224
LmnI GCTCC 1 cut(s) 138
LpnPI CCDG 9 cut(s) 51, 81, 100, 107, 149, 167, 188, 197, 203
MaeI CTAG 1 cut(s) 27
MaeII ACGT 1 cut(s) 78
MboII GAAGA 3 cut(s) 71, 160, 181
MluCI AATT 1 cut(s) 210
MnlI CCTC 8 cut(s) 34, 75, 90, 93, 111, 114, 150, 153
MseI TTAA 1 cut(s) 129
MspI CCGG 4 cut(s) 38, 136, 154, 175
MspR9I CCNGG 3 cut(s) 136, 154, 175
MvnI CGCG 1 cut(s) 224
NciI CCSGG 3 cut(s) 136, 154, 175
NlaIV GGNNCC 1 cut(s) 140
PcsI WCGNNNNNNNCGW 1 cut(s) 228
PflMI CCANNNNNTGG 1 cut(s) 196
PspN4I GGNNCC 1 cut(s) 140
PspPI GGNCC 2 cut(s) 8, 199
SaqAI TTAA 1 cut(s) 129
Sau96I GGNCC 2 cut(s) 8, 199
ScrFI CCNGG 3 cut(s) 136, 154, 175
SetI ASST 2 cut(s) 45, 81
SinI GGWCC 2 cut(s) 8, 199
Sse9I AATT 1 cut(s) 210
SspMI CTAG 1 cut(s) 27
StyD4I CCNGG 3 cut(s) 134, 152, 173
TaiI ACGT 1 cut(s) 81
TasI AATT 1 cut(s) 210
Tru1I TTAA 1 cut(s) 129
Tru9I TTAA 1 cut(s) 129
TscAI CASTG 1 cut(s) 75
TspDTI ATGAA 1 cut(s) 72
TspRI CASTG 1 cut(s) 75
Van91I CCANNNNNTGG 1 cut(s) 196
VpaK11BI GGWCC 2 cut(s) 8, 199
XspI CTAG 1 cut(s) 27
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.