Rh3AG335500

UDP-sugar transporter

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
Physical Location & Seq
Reverse (-)
48813600 .. 48814963
1364 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG335500.1

Sequence Viewer

Length: 258 bp
ATGGTTTCGAATTTATTGGTTGTCTTGCTCTGTTCCTGTGTACTGGCATTCTTCCTGAATTACTGTATATTTCTTAATACGACAATAAATTCAGCACTAACGCAGACAATTTGCGGTAACTTGAAGGATTTCTTTACCATTGGACTTGGCTGGGTGATATTTGGTGGCCTTCCATTTGATATTTTGAATGTCATTGGGCAATGTCTCAATTTTCTTGGTTCTAGATTGTACGCATACAATAAGCTCATAGGGAAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

85

Amino Acids

9.39

Weight (kDa)

8.35

Isoelectric Point (pI)

23.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021370)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr3g0497301
rosa_rugosa Rorug05G0242900
rosa_samantha Rh2AG484800 Rh3AG335500 Rh4DG262000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 114
AcsI RAATTY 2 cut(s) 10, 88
AfaI GTAC 2 cut(s) 42, 230
AgsI TTSAA 2 cut(s) 124, 187
AluBI AGCT 1 cut(s) 244
AluI AGCT 1 cut(s) 244
Alw26I GTCTC 1 cut(s) 209
AoxI GGCC 1 cut(s) 166
ApoI RAATTY 2 cut(s) 10, 88
Asp700I GAANNNNTTC 1 cut(s) 128
AsuHPI GGTGA 1 cut(s) 166
AsuII TTCGAA 1 cut(s) 8
BcoDI GTCTC 1 cut(s) 209
BfaI CTAG 1 cut(s) 222
Bpu14I TTCGAA 1 cut(s) 8
Bse1I ACTGG 1 cut(s) 48
Bse3DI GCAATG 1 cut(s) 206
BseMI GCAATG 1 cut(s) 206
BseNI ACTGG 1 cut(s) 48
BseYI CCCAGC 1 cut(s) 150
BshFI GGCC 1 cut(s) 168
BsmAI GTCTC 1 cut(s) 209
BsmI GAATGC 1 cut(s) 47
BsnI GGCC 1 cut(s) 168
Bsp119I TTCGAA 1 cut(s) 8
BspACI CCGC 1 cut(s) 114
BspANI GGCC 1 cut(s) 168
BspT104I TTCGAA 1 cut(s) 8
BsrDI GCAATG 1 cut(s) 206
BsrI ACTGG 1 cut(s) 48
Bst4CI ACNGT 1 cut(s) 65
BstBI TTCGAA 1 cut(s) 8
BstMAI GTCTC 1 cut(s) 209
BsuRI GGCC 1 cut(s) 168
Csp6I GTAC 2 cut(s) 41, 229
CviJI RGCY 3 cut(s) 150, 168, 244
CviKI_1 RGCY 3 cut(s) 150, 168, 244
CviQI GTAC 2 cut(s) 41, 229
FaiI YATR 3 cut(s) 68, 235, 248
FalI AAGNNNNNCTT 2 cut(s) 116, 148
FspBI CTAG 1 cut(s) 222
GsaI CCCAGC 1 cut(s) 154
HaeIII GGCC 1 cut(s) 168
HphI GGTGA 1 cut(s) 166
Hpy166II GTNNAC 1 cut(s) 41
Hpy188III TCNNGA 2 cut(s) 55, 222
Hpy8I GTNNAC 1 cut(s) 41
HpyAV CCTTC 2 cut(s) 118, 179
HpyCH4III ACNGT 1 cut(s) 65
LpnPI CCDG 4 cut(s) 29, 49, 68, 136
MaeI CTAG 1 cut(s) 222
MaeIII GTNAC 1 cut(s) 116
MboII GAAGA 1 cut(s) 43
MluCI AATT 5 cut(s) 10, 58, 88, 108, 208
MroXI GAANNNNTTC 1 cut(s) 128
MseI TTAA 1 cut(s) 75
Mva1269I GAATGC 1 cut(s) 47
NspV TTCGAA 1 cut(s) 8
PctI GAATGC 1 cut(s) 47
PdmI GAANNNNTTC 1 cut(s) 128
PspFI CCCAGC 1 cut(s) 150
RsaI GTAC 2 cut(s) 42, 230
RsaNI GTAC 2 cut(s) 41, 229
SaqAI TTAA 1 cut(s) 75
SetI ASST 1 cut(s) 246
SfuI TTCGAA 1 cut(s) 8
SgeI CNNG 9 cut(s) 37, 48, 56, 67, 133, 158, 163, 227, 234
Sse9I AATT 5 cut(s) 10, 58, 88, 108, 208
SsiI CCGC 1 cut(s) 114
SspMI CTAG 1 cut(s) 222
TaaI ACNGT 1 cut(s) 65
TaqI TCGA 1 cut(s) 8
TasI AATT 5 cut(s) 10, 58, 88, 108, 208
TatI WGTACW 1 cut(s) 40
Tru1I TTAA 1 cut(s) 75
Tru9I TTAA 1 cut(s) 75
XapI RAATTY 2 cut(s) 10, 88
XbaI TCTAGA 1 cut(s) 221
XmnI GAANNNNTTC 1 cut(s) 128
XspI CTAG 1 cut(s) 222
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.