Rh3BG009900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Forward (+)
643793 .. 644083
291 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG009900.1

Sequence Viewer

Length: 291 bp
ATGAACCTTAAGAATCGAAATGTTCCTCACAACCATTTGATCATAGCCAATATTCACAAAAGTAAAAAAAGTTTTCATCCTCTCATTTCAGTGTCTTCACCGTCTTCATCAGGGCTTGCTGGTTCTTTAACATCGACAGTGAAGTTATGTTCCTCATCACACCCCAAATATGAATCACACATGAAATACAGTGTATATGTCTTCTTTCCAGCTTCTGCAGAAGCCGAAAATCTAAGCTGGATCTTCGACTTCTTTAGTAGGGGAACTTTCTTGATTGCAAGCAGTGAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

96

Amino Acids

10.65

Weight (kDa)

9.46

Isoelectric Point (pI)

48.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021864)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G21580 AT4G21580
rosa_samantha Rh3BG009900 Rh3DG010400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 248
AflII CTTAAG 1 cut(s) 8
AluBI AGCT 2 cut(s) 212, 237
AluI AGCT 2 cut(s) 212, 237
AlwI GGATC 1 cut(s) 248
AlwNI CAGNNNCTG 1 cut(s) 215
AsuHPI GGTGA 1 cut(s) 90
BbsI GAAGAC 3 cut(s) 87, 96, 193
BclI TGATCA 1 cut(s) 39
BfmI CTRYAG 1 cut(s) 216
BfrI CTTAAG 1 cut(s) 8
BpiI GAAGAC 3 cut(s) 87, 96, 193
BseGI GGATG 1 cut(s) 76
Bsp143I GATC 2 cut(s) 39, 240
BspMAI CTGCAG 1 cut(s) 220
BspPI GGATC 1 cut(s) 248
BspTI CTTAAG 1 cut(s) 8
BssMI GATC 2 cut(s) 39, 240
Bst4CI ACNGT 3 cut(s) 102, 139, 191
BstAFI CTTAAG 1 cut(s) 8
BstC8I GCNNGC 2 cut(s) 117, 280
BstDEI CTNAG 1 cut(s) 233
BstF5I GGATG 1 cut(s) 76
BstKTI GATC 2 cut(s) 42, 243
BstMBI GATC 2 cut(s) 39, 240
BstSFI CTRYAG 1 cut(s) 216
BstV2I GAAGAC 3 cut(s) 87, 96, 193
BstX2I RGATCY 1 cut(s) 240
BstYI RGATCY 1 cut(s) 240
BtsCI GGATG 1 cut(s) 76
BtsI GCAGTG 1 cut(s) 289
BtsIMutI CAGTG 4 cut(s) 96, 144, 196, 289
Cac8I GCNNGC 2 cut(s) 117, 280
CaiI CAGNNNCTG 1 cut(s) 215
CviAII CATG 1 cut(s) 181
CviJI RGCY 5 cut(s) 47, 115, 212, 224, 237
CviKI_1 RGCY 5 cut(s) 47, 115, 212, 224, 237
DdeI CTNAG 1 cut(s) 233
DpnI GATC 2 cut(s) 41, 242
DpnII GATC 2 cut(s) 39, 240
FaeI CATG 1 cut(s) 184
FaiI YATR 6 cut(s) 44, 148, 171, 182, 196, 198
FatI CATG 1 cut(s) 180
FbaI TGATCA 1 cut(s) 39
FokI GGATG 1 cut(s) 63
Hin1II CATG 1 cut(s) 184
HinfI GANTC 2 cut(s) 13, 173
HphI GGTGA 1 cut(s) 90
Hpy188III TCNNGA 1 cut(s) 271
HpyCH4III ACNGT 3 cut(s) 102, 139, 191
HpyCH4V TGCA 2 cut(s) 218, 278
HpyF3I CTNAG 1 cut(s) 233
Hsp92II CATG 1 cut(s) 184
Ksp22I TGATCA 1 cut(s) 39
Kzo9I GATC 2 cut(s) 39, 240
LpnPI CCDG 4 cut(s) 96, 105, 222, 223
MalI GATC 2 cut(s) 41, 242
MboI GATC 2 cut(s) 39, 240
MboII GAAGA 4 cut(s) 87, 96, 193, 235
MflI RGATCY 1 cut(s) 240
MnlI CCTC 3 cut(s) 36, 90, 163
MseI TTAA 2 cut(s) 9, 128
MslI CAYNNNNRTG 1 cut(s) 89
MspCI CTTAAG 1 cut(s) 8
NdeII GATC 2 cut(s) 39, 240
NlaIII CATG 1 cut(s) 184
PfeI GAWTC 2 cut(s) 13, 173
PstI CTGCAG 1 cut(s) 220
PstNI CAGNNNCTG 1 cut(s) 215
PsuI RGATCY 1 cut(s) 240
RseI CAYNNNNRTG 1 cut(s) 89
SaqAI TTAA 2 cut(s) 9, 128
Sau3AI GATC 2 cut(s) 39, 240
SetI ASST 3 cut(s) 9, 214, 239
SfcI CTRYAG 1 cut(s) 216
SgeI CNNG 7 cut(s) 123, 128, 132, 193, 221, 250, 283
SmiMI CAYNNNNRTG 1 cut(s) 89
SmlI CTYRAG 1 cut(s) 8
SmoI CTYRAG 1 cut(s) 8
SspI AATATT 1 cut(s) 52
TaaI ACNGT 3 cut(s) 102, 139, 191
TaqI TCGA 3 cut(s) 16, 134, 246
TfiI GAWTC 2 cut(s) 13, 173
Tru1I TTAA 2 cut(s) 9, 128
Tru9I TTAA 2 cut(s) 9, 128
TscAI CASTG 4 cut(s) 96, 144, 196, 289
TspDTI ATGAA 5 cut(s) 17, 65, 96, 186, 197
TspRI CASTG 4 cut(s) 96, 144, 196, 289
Vha464I CTTAAG 1 cut(s) 8
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.