Rh4AG117800

receptor-like protein kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Forward (+)
25350999 .. 25351251
253 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG117800.1

Sequence Viewer

Length: 204 bp
ATGGATTTAAAACACTTGTACCAGGTCCATTTAAAACACTATATTGATACTCCTAGACGTGTTGCTGCTGTGGCAGTATTATGTGTGCAACTTGAACCAAGTTATCGACCTTTGGTAACGGATGTACTGCACTCGCTAATCCCTCTTGTGCCTATGGATCTCGGAGGATCGCTGGGAATTACAGACTGCATACCCTCTGTTTGA

Protein Analysis

67

Amino Acids

7.42

Weight (kDa)

6.37

Isoelectric Point (pI)

25.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0030061)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0403071
rosa_samantha Rh4AG117800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 165, 175
AfaI GTAC 2 cut(s) 20, 126
AflIII ACRYGT 1 cut(s) 58
AgsI TTSAA 1 cut(s) 95
AjiI CACGTC 1 cut(s) 59
AjnI CCWGG 1 cut(s) 21
AlwI GGATC 2 cut(s) 165, 175
ApeKI GCWGC 1 cut(s) 65
AspS9I GGNCC 1 cut(s) 25
AvaII GGWCC 1 cut(s) 25
BaeI ACNNNNGTAYC 1 cut(s) 35
BbvI GCAGC 1 cut(s) 52
BciT130I CCWGG 1 cut(s) 23
BfaI CTAG 1 cut(s) 54
BisI GCNGC 1 cut(s) 66
BlsI GCNGC 1 cut(s) 67
Bme1390I CCNGG 1 cut(s) 23
Bme18I GGWCC 1 cut(s) 25
BmgBI CACGTC 1 cut(s) 59
BmgT120I GGNCC 1 cut(s) 25
BmrFI CCNGG 1 cut(s) 23
BseBI CCWGG 1 cut(s) 23
BseGI GGATG 1 cut(s) 127
BseXI GCAGC 1 cut(s) 52
BseYI CCCAGC 1 cut(s) 172
BsgI GTGCAG 1 cut(s) 113
Bsp143I GATC 2 cut(s) 157, 167
BspPI GGATC 2 cut(s) 165, 175
BssMI GATC 2 cut(s) 157, 167
Bst2UI CCWGG 1 cut(s) 23
BstF5I GGATG 1 cut(s) 127
BstKTI GATC 2 cut(s) 160, 170
BstMBI GATC 2 cut(s) 157, 167
BstMWI GCNNNNNNNGC 1 cut(s) 71
BstNI CCWGG 1 cut(s) 23
BstSCI CCNGG 1 cut(s) 21
BstV1I GCAGC 1 cut(s) 52
BstX2I RGATCY 1 cut(s) 157
BstYI RGATCY 1 cut(s) 157
BtrI CACGTC 1 cut(s) 59
BtsCI GGATG 1 cut(s) 127
Cfr13I GGNCC 1 cut(s) 25
CsiI ACCWGGT 1 cut(s) 21
Csp6I GTAC 2 cut(s) 19, 125
CviQI GTAC 2 cut(s) 19, 125
DpnI GATC 2 cut(s) 159, 169
DpnII GATC 2 cut(s) 157, 167
DraI TTTAAA 2 cut(s) 9, 33
Eco47I GGWCC 1 cut(s) 25
EcoRII CCWGG 1 cut(s) 21
FaiI YATR 4 cut(s) 42, 82, 155, 191
Fnu4HI GCNGC 1 cut(s) 66
FokI GGATG 1 cut(s) 134
Fsp4HI GCNGC 1 cut(s) 66
FspBI CTAG 1 cut(s) 54
GluI GCNGC 1 cut(s) 66
GsaI CCCAGC 1 cut(s) 176
Hpy188I TCNGA 1 cut(s) 164
HpyCH4IV ACGT 1 cut(s) 58
HpyCH4V TGCA 3 cut(s) 88, 130, 189
HpyF10VI GCNNNNNNNGC 1 cut(s) 71
HpySE526I ACGT 1 cut(s) 58
Kzo9I GATC 2 cut(s) 157, 167
LpnPI CCDG 3 cut(s) 8, 35, 158
Lsp1109I GCAGC 1 cut(s) 52
MabI ACCWGGT 1 cut(s) 21
MaeI CTAG 1 cut(s) 54
MaeII ACGT 1 cut(s) 58
MaeIII GTNAC 1 cut(s) 115
MalI GATC 2 cut(s) 159, 169
MboI GATC 2 cut(s) 157, 167
MflI RGATCY 1 cut(s) 157
MluCI AATT 1 cut(s) 177
MnlI CCTC 2 cut(s) 153, 158
MseI TTAA 2 cut(s) 8, 32
MspR9I CCNGG 1 cut(s) 23
MvaI CCWGG 1 cut(s) 23
MwoI GCNNNNNNNGC 1 cut(s) 71
NdeII GATC 2 cut(s) 157, 167
PkrI GCNGC 1 cut(s) 67
Psp6I CCWGG 1 cut(s) 21
PspFI CCCAGC 1 cut(s) 172
PspGI CCWGG 1 cut(s) 21
PspPI GGNCC 1 cut(s) 25
PsuI RGATCY 1 cut(s) 157
RsaI GTAC 2 cut(s) 20, 126
RsaNI GTAC 2 cut(s) 19, 125
SaqAI TTAA 2 cut(s) 8, 32
SatI GCNGC 1 cut(s) 66
Sau3AI GATC 2 cut(s) 157, 167
Sau96I GGNCC 1 cut(s) 25
ScrFI CCNGG 1 cut(s) 23
SetI ASST 3 cut(s) 27, 61, 112
SexAI ACCWGGT 1 cut(s) 21
SinI GGWCC 1 cut(s) 25
Sse9I AATT 1 cut(s) 177
SspMI CTAG 1 cut(s) 54
StyD4I CCNGG 1 cut(s) 21
TaiI ACGT 1 cut(s) 61
TaqI TCGA 1 cut(s) 106
TasI AATT 1 cut(s) 177
TatI WGTACW 1 cut(s) 124
Tru1I TTAA 2 cut(s) 8, 32
Tru9I TTAA 2 cut(s) 8, 32
TseI GCWGC 1 cut(s) 65
TspGWI ACGGA 1 cut(s) 134
VpaK11BI GGWCC 1 cut(s) 25
XspI CTAG 1 cut(s) 54
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.