Rh4AG321400
WRKY Family

WRKY transcription factor

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Forward (+)
63400261 .. 63400575
315 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG321400.1

Sequence Viewer

Length: 210 bp
ATGTCTAAGCAGGGTCAGGAATCTAGCCAAGCAATATCTGGGACAAGTGACAGTGAGGAAGTTGGAGATGCTGAAAGTGAGGAAGTTGGGGATGCTGAAACAGAAGTAGAAGAAAAAGATGAAGATGAATCTGGTGCCAGGAGACGAGATATGGAGGTCAGGCATTTGGAGCCAGCTAGCTCCTTCTCATCGGACTGTGACAGTGCCTAG

Protein Analysis

69

Amino Acids

7.43

Weight (kDa)

4.05

Isoelectric Point (pI)

95.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0032678)

Species Orthologous Gene IDs
rosa_samantha Rh4AG321400 Rh4DG325200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 134
AjnI CCWGG 1 cut(s) 137
AluBI AGCT 2 cut(s) 176, 180
AluI AGCT 2 cut(s) 176, 180
Alw26I GTCTC 1 cut(s) 136
AsuNHI GCTAGC 1 cut(s) 176
BanI GGYRCC 1 cut(s) 134
BciT130I CCWGG 1 cut(s) 139
BcoDI GTCTC 1 cut(s) 136
BfaI CTAG 3 cut(s) 24, 177, 208
Bme1390I CCNGG 1 cut(s) 139
BmiI GGNNCC 2 cut(s) 136, 171
BmrFI CCNGG 1 cut(s) 139
BmsI GCATC 2 cut(s) 58, 82
BmtI GCTAGC 1 cut(s) 180
BseBI CCWGG 1 cut(s) 139
BseGI GGATG 1 cut(s) 97
BshNI GGYRCC 1 cut(s) 134
BslFI GGGAC 1 cut(s) 55
BsmAI GTCTC 1 cut(s) 136
BsmBI CGTCTC 1 cut(s) 136
BsmFI GGGAC 1 cut(s) 55
BspLI GGNNCC 2 cut(s) 136, 171
BspOI GCTAGC 1 cut(s) 180
BspT107I GGYRCC 1 cut(s) 134
Bst2UI CCWGG 1 cut(s) 139
Bst4CI ACNGT 3 cut(s) 53, 197, 203
BstC8I GCNNGC 2 cut(s) 174, 178
BstDEI CTNAG 1 cut(s) 6
BstF5I GGATG 1 cut(s) 97
BstMAI GTCTC 1 cut(s) 136
BstMWI GCNNNNNNNGC 1 cut(s) 169
BstNI CCWGG 1 cut(s) 139
BstSCI CCNGG 1 cut(s) 137
BtsCI GGATG 1 cut(s) 97
BtsIMutI CAGTG 2 cut(s) 58, 208
Cac8I GCNNGC 2 cut(s) 174, 178
CviJI RGCY 4 cut(s) 27, 172, 176, 180
CviKI_1 RGCY 4 cut(s) 27, 172, 176, 180
DdeI CTNAG 1 cut(s) 6
EcoRII CCWGG 1 cut(s) 137
Esp3I CGTCTC 1 cut(s) 136
FaiI YATR 1 cut(s) 152
FaqI GGGAC 1 cut(s) 55
FokI GGATG 1 cut(s) 104
FspBI CTAG 3 cut(s) 24, 177, 208
HinfI GANTC 2 cut(s) 20, 128
Hpy188I TCNGA 1 cut(s) 193
Hpy188III TCNNGA 1 cut(s) 17
HpyAV CCTTC 1 cut(s) 193
HpyCH4III ACNGT 3 cut(s) 53, 197, 203
HpyF10VI GCNNNNNNNGC 1 cut(s) 169
HpyF3I CTNAG 1 cut(s) 6
LmnI GCTCC 2 cut(s) 169, 185
LpnPI CCDG 7 cut(s) 2, 24, 117, 124, 145, 151, 186
LweI GCATC 2 cut(s) 58, 82
MaeI CTAG 3 cut(s) 24, 177, 208
MaeIII GTNAC 2 cut(s) 47, 197
MboII GAAGA 2 cut(s) 122, 134
MmeI TCCRAC 1 cut(s) 43
MnlI CCTC 3 cut(s) 49, 73, 148
MspR9I CCNGG 1 cut(s) 139
MvaI CCWGG 1 cut(s) 139
MwoI GCNNNNNNNGC 1 cut(s) 169
NheI GCTAGC 1 cut(s) 176
NlaIV GGNNCC 2 cut(s) 136, 171
NmuCI GTSAC 2 cut(s) 47, 197
PfeI GAWTC 2 cut(s) 20, 128
Psp6I CCWGG 1 cut(s) 137
PspGI CCWGG 1 cut(s) 137
PspN4I GGNNCC 2 cut(s) 136, 171
ScrFI CCNGG 1 cut(s) 139
SetI ASST 3 cut(s) 159, 178, 182
SfaNI GCATC 2 cut(s) 58, 82
SspMI CTAG 3 cut(s) 24, 177, 208
StyD4I CCNGG 1 cut(s) 137
TaaI ACNGT 3 cut(s) 53, 197, 203
TfiI GAWTC 2 cut(s) 20, 128
TscAI CASTG 2 cut(s) 58, 208
TseFI GTSAC 2 cut(s) 47, 197
Tsp45I GTSAC 2 cut(s) 47, 197
TspDTI ATGAA 2 cut(s) 135, 141
TspRI CASTG 2 cut(s) 58, 208
XcmI CCANNNNNNNNNTGG 1 cut(s) 35
XspI CTAG 3 cut(s) 24, 177, 208
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.