Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr4C

Orthogroup ID

OG0025469

Physical Location & Seq

Genomic Coordinates Reverse (-)

45439915 .. 45440292

Gene Structure 378 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh4CG220500.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 378 bp

ATGGGCCGAAGCTGGGGGTTCCTGATCGAAATTCGAGAGATTCTAACTCAAACTCTCTTTGTGATGACTACTCAAAGACCTTTGAGATGTCATTTCGCGGTGGTGATTAGGTGTCTCGTGGTGGGGAATGGGGAGAGGAAAGATTGTAAGCAGAAGTCTAGAAGGTGGAGCAAGGCCTGGAACATTTGGAGTTTCATACACAGAAAGAGTGGGAACAAGGAGGATGATGAAGATAGGTATAGTAGTAGGCCTAATGGGGTAGAAAGGTTGTTTTCGGAGTCTTGGTCGGAGCTGAGAGGCAACGGAGAGCGAAATGGGGAAGCAAAGGGTTTCAATCCAAAGATTACGAGGAGCAACAGCCTTGCTCTTGAGTTTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0003002 GO:0003006 GO:0005575 GO:0005623 GO:0005886 GO:0006810 GO:0007275 GO:0007389 GO:0008150 GO:0009653 GO:0009790 GO:0009791 GO:0009793 GO:0009888 GO:0009965 GO:0010016 GO:0010051 GO:0010087 GO:0010088 GO:0010154 GO:0010232 GO:0010233 GO:0010588 GO:0016020 GO:0016324 GO:0022414 GO:0022622 GO:0032501 GO:0032502 GO:0044425 GO:0044459 GO:0044464 GO:0045177 GO:0048316 GO:0048366 GO:0048367 GO:0048598 GO:0048608 GO:0048731 GO:0048825 GO:0048826 GO:0048827 GO:0048856 GO:0051179 GO:0051234 GO:0061458 GO:0071944 GO:0090698 GO:0098590 GO:0099402 GO:1905392

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF740

Protein Analysis

125

Amino Acids

14.64

Weight (kDa)

9.94

Isoelectric Point (pI)

51.25

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
DUF740	PF05340	39 - 120	8.2e-25	Protein of unknown function (DUF740)

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025469)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_sc0000032.1_g000010
rosa_samantha	Rh4BG209600 Rh4CG220500

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	1 cut(s)	98
AciI	CCGC	1 cut(s)	98
AcsI	RAATTY	1 cut(s)	30
AfiI	CCNNNNNNNGG	1 cut(s)	13
AgsI	TTSAA	1 cut(s)	334
AjnI	CCWGG	1 cut(s)	176
AluBI	AGCT	2 cut(s)	12, 292
AluI	AGCT	2 cut(s)	12, 292
Alw26I	GTCTC	1 cut(s)	119
AoxI	GGCC	3 cut(s)	4, 174, 248
ApoI	RAATTY	1 cut(s)	30
AspS9I	GGNCC	1 cut(s)	4
AsuHPI	GGTGA	1 cut(s)	115
BauI	CACGAG	1 cut(s)	116
BciT130I	CCWGG	1 cut(s)	178
BcoDI	GTCTC	1 cut(s)	119
BfaI	CTAG	1 cut(s)	159
Bme1390I	CCNGG	1 cut(s)	178
BmgT120I	GGNCC	1 cut(s)	4
BmiI	GGNNCC	1 cut(s)	20
BmrFI	CCNGG	1 cut(s)	178
BsaXI	ACNNNNNCTCC	2 cut(s)	269, 299
Bsc4I	CCNNNNNNNGG	1 cut(s)	13
BseBI	CCWGG	1 cut(s)	178
BseGI	GGATG	1 cut(s)	229
BseLI	CCNNNNNNNGG	1 cut(s)	13
BseMII	CTCAG	1 cut(s)	284
BseRI	GAGGAG	1 cut(s)	364
BseYI	CCCAGC	1 cut(s)	12
Bsh1236I	CGCG	1 cut(s)	98
BshFI	GGCC	3 cut(s)	6, 176, 250
BslI	CCNNNNNNNGG	1 cut(s)	13
BsmAI	GTCTC	1 cut(s)	119
BsnI	GGCC	3 cut(s)	6, 176, 250
Bsp143I	GATC	1 cut(s)	24
BspACI	CCGC	1 cut(s)	98
BspANI	GGCC	3 cut(s)	6, 176, 250
BspCNI	CTCAG	1 cut(s)	285
BspFNI	CGCG	1 cut(s)	98
BspLI	GGNNCC	1 cut(s)	20
BssMI	GATC	1 cut(s)	24
BssSI	CACGAG	1 cut(s)	116
Bst2BI	CACGAG	1 cut(s)	116
Bst2UI	CCWGG	1 cut(s)	178
BstDEI	CTNAG	1 cut(s)	293
BstF5I	GGATG	1 cut(s)	229
BstFNI	CGCG	1 cut(s)	98
BstKTI	GATC	1 cut(s)	27
BstMAI	GTCTC	1 cut(s)	119
BstMBI	GATC	1 cut(s)	24
BstNI	CCWGG	1 cut(s)	178
BstSCI	CCNGG	1 cut(s)	176
BstUI	CGCG	1 cut(s)	98
BsuRI	GGCC	3 cut(s)	6, 176, 250
BtsCI	GGATG	1 cut(s)	229
Cfr13I	GGNCC	1 cut(s)	4
CviJI	RGCY	6 cut(s)	6, 12, 176, 250, 292, 360
CviKI_1	RGCY	6 cut(s)	6, 12, 176, 250, 292, 360
DdeI	CTNAG	1 cut(s)	293
DpnI	GATC	1 cut(s)	26
DpnII	GATC	1 cut(s)	24
Eco147I	AGGCCT	2 cut(s)	176, 250
EcoRII	CCWGG	1 cut(s)	176
FaiI	YATR	2 cut(s)	197, 240
FokI	GGATG	1 cut(s)	236
FspBI	CTAG	1 cut(s)	159
GsaI	CCCAGC	1 cut(s)	16
HaeIII	GGCC	3 cut(s)	6, 176, 250
HinfI	GANTC	2 cut(s)	40, 278
HphI	GGTGA	1 cut(s)	115
Hpy188I	TCNGA	2 cut(s)	277, 289
Hpy188III	TCNNGA	4 cut(s)	22, 35, 159, 368
HpyAV	CCTTC	1 cut(s)	156
HpyF3I	CTNAG	1 cut(s)	293
Kzo9I	GATC	1 cut(s)	24
LmnI	GCTCC	3 cut(s)	168, 289, 351
LpnPI	CCDG	3 cut(s)	35, 163, 190
MaeI	CTAG	1 cut(s)	159
MalI	GATC	1 cut(s)	26
MboI	GATC	1 cut(s)	24
MboII	GAAGA	1 cut(s)	242
MluCI	AATT	1 cut(s)	30
MlyI	GAGTC	1 cut(s)	287
MmeI	TCCRAC	1 cut(s)	267
MnlI	CCTC	4 cut(s)	129, 214, 290, 342
MseI	TTAA	1 cut(s)	376
MspR9I	CCNGG	1 cut(s)	178
MvaI	CCWGG	1 cut(s)	178
MvnI	CGCG	1 cut(s)	98
NdeII	GATC	1 cut(s)	24
NlaIV	GGNNCC	1 cut(s)	20
PceI	AGGCCT	2 cut(s)	176, 250
PfeI	GAWTC	1 cut(s)	40
PleI	GAGTC	1 cut(s)	286
PpsI	GAGTC	1 cut(s)	286
Psp6I	CCWGG	1 cut(s)	176
PspFI	CCCAGC	1 cut(s)	12
PspGI	CCWGG	1 cut(s)	176
PspN4I	GGNNCC	1 cut(s)	20
PspPI	GGNCC	1 cut(s)	4
SaqAI	TTAA	1 cut(s)	376
Sau3AI	GATC	1 cut(s)	24
Sau96I	GGNCC	1 cut(s)	4
SchI	GAGTC	1 cut(s)	287
ScrFI	CCNGG	1 cut(s)	178
SetI	ASST	7 cut(s)	14, 82, 113, 167, 239, 269, 294
SmlI	CTYRAG	1 cut(s)	368
SmoI	CTYRAG	1 cut(s)	368
Sse9I	AATT	1 cut(s)	30
SseBI	AGGCCT	2 cut(s)	176, 250
SsiI	CCGC	1 cut(s)	98
SspMI	CTAG	1 cut(s)	159
StuI	AGGCCT	2 cut(s)	176, 250
StyD4I	CCNGG	1 cut(s)	176
TaqI	TCGA	2 cut(s)	27, 34
TasI	AATT	1 cut(s)	30
TfiI	GAWTC	1 cut(s)	40
Tru1I	TTAA	1 cut(s)	376
Tru9I	TTAA	1 cut(s)	376
TspDTI	ATGAA	2 cut(s)	184, 243
TspGWI	ACGGA	1 cut(s)	318
XapI	RAATTY	1 cut(s)	30
XbaI	TCTAGA	1 cut(s)	158
XspI	CTAG	1 cut(s)	159

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.